View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5523_low_10 (Length: 292)
Name: NF5523_low_10
Description: NF5523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5523_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 17 - 281
Target Start/End: Complemental strand, 42272293 - 42272029
Alignment:
| Q |
17 |
tttgaagcccttgtttctttgactcagataagtttgagtatctcatattaggcctttgtggatggattccaacaactggccttccaagcctactattaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42272293 |
tttgaagcccttgtttctttgactcagataagtttgagtatctcatattaggcctttgtggatggattccaacaactggccttccaagcctactattaaa |
42272194 |
T |
 |
| Q |
117 |
ggatataacatctgagaaatttttggtgcatggtgaaatatttggcaacccttcataaaatttgccattgtgatctcccactgagttaaatccatcaagg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42272193 |
ggatataacatctgagaaatttttggtgcatggtgaaatatttggcaacccttcataaaatttgccattgtgatctcccactgagttaaatccatcaaga |
42272094 |
T |
 |
| Q |
217 |
aatccatttggattaagtgattttctaaatacatgtccttgcatcacttcacttgcatgatgatg |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42272093 |
tatccatttggattaagtgattttctaaatacatgtccttgcatcacttcacttgcatgatgatg |
42272029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University