View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5523_low_13 (Length: 264)
Name: NF5523_low_13
Description: NF5523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5523_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 18 - 250
Target Start/End: Original strand, 12869955 - 12870182
Alignment:
| Q |
18 |
gaaggggagcctactatggttaacattaatcgaacaaggccggtcaagtttgtttctttatggcggaaagatatttgtgatttagatagataaagtgagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12869955 |
gaaggggagcctactatggttaacattaatcgaacaaggccggtcaagtttgtttctttatggcggaaagatatttgtgatt----tagataaagtgagg |
12870050 |
T |
 |
| Q |
118 |
gagtcgaacctagattggtttcttgaatatgcaaagaagaaaatagggaatggtgtcgctacannnnnnnngcgtgagccttggctttcaatttaccgct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12870051 |
gagtcgaacctagattggtttcttgaatatgcaaagaagaaaatagggaatggtgtcgctacattttttttgcgtgagccttggctttcaatttaccgct |
12870150 |
T |
 |
| Q |
218 |
ttgcaacgcttttccttatactttttcctatgc |
250 |
Q |
| |
|
||| |||||||||| || |||||||||||||| |
|
|
| T |
12870151 |
ttgtgacgcttttcc-tagactttttcctatgc |
12870182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University