View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5523_low_14 (Length: 249)
Name: NF5523_low_14
Description: NF5523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5523_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 41001518 - 41001287
Alignment:
| Q |
1 |
gatggtgatatccctatctagaggatgtgtcaagcaacagaaactccattgaagtaaacattgcacacaattttggacaatcaacctcaaacttgcaacc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41001518 |
gatggtgatatccctatctagaggatgtgtcaagcaacacaaactccattgaagtaaacattgcacacaagtttggacaatcaacctcaaacttgcaacc |
41001419 |
T |
|
| Q |
101 |
ttctaacactgcatattgatattacaatgaagagagatatgggcatcatcctcaactgcatccatggacaacgaacaatttttcggatatgggacgcgag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41001418 |
ttctaacactgcatattgatattacaatgaagagagatatgggcatcgtcctcaactgcatccatggacaacaaacaatttttcggatatgggacgcgag |
41001319 |
T |
|
| Q |
201 |
gattgtttaaccgctgacgcattggcaaagaa |
232 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |
|
|
| T |
41001318 |
gatcgtttaaccgctgacgcattggcaaagaa |
41001287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University