View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5523_low_17 (Length: 238)

Name: NF5523_low_17
Description: NF5523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5523_low_17
NF5523_low_17
[»] chr4 (2 HSPs)
chr4 (49-224)||(26164031-26164203)
chr4 (173-224)||(26182464-26182515)


Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 49 - 224
Target Start/End: Original strand, 26164031 - 26164203
Alignment:
49 ttaatgtcccaattgattatccaagttgatatactactatccaagtagattatctaagaagaagaaaattaactgcaagggcctttaaccaggaagaaga 148  Q
    ||||||||  |||||||||||||||||||||||||||||||||||| ||||||| ||||   ||||||||||||||||||||||||||||| ||||||||    
26164031 ttaatgtcttaattgattatccaagttgatatactactatccaagttgattatccaaga---agaaaattaactgcaagggcctttaaccaagaagaaga 26164127  T
149 aaaatagaatattgacaaatatacaattgccttgtttggttcattacgggaaaatgaggagagtgaagtaaatatt 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
26164128 aaaatagaatattgacaaatatacaattgccttgtttggttcattgcgggaaaatgaggagagtgaagtaaatatt 26164203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 26182464 - 26182515
Alignment:
173 aattgccttgtttggttcattacgggaaaatgaggagagtgaagtaaatatt 224  Q
    |||||| || ||||||||||||||||||||||||||||||||||||||||||    
26182464 aattgcattatttggttcattacgggaaaatgaggagagtgaagtaaatatt 26182515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University