View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5523_low_20 (Length: 215)
Name: NF5523_low_20
Description: NF5523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5523_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 22 - 195
Target Start/End: Complemental strand, 5605615 - 5605442
Alignment:
| Q |
22 |
ggaagcggccatttcggccaaatgcactaatcatggccgaaaaggaatacacagtgcttccatacccttcaagcctagctctttcaaacaatcccaaagc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5605615 |
ggaagcggccatttcggccaaatgcactaatcatggccgaaaaggaatgcacagtgcttccatacccttcaagcctagctctttcaaacaatcccaaagc |
5605516 |
T |
|
| Q |
122 |
aagattaatctcccctaacctaccaagagtgccaatcatagcactaactaacttgcctttatcaaccctcccat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5605515 |
aagattaatctcccctaacctaccaagagtgccaatcatagcactaactaacttgcctttatcaaccctcccat |
5605442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 30 - 195
Target Start/End: Original strand, 5595305 - 5595470
Alignment:
| Q |
30 |
ccatttcggccaaatgcactaatcatggccgaaaaggaatacacagtgcttccatacccttcaagcctagctctttcaaacaatcccaaagcaagattaa |
129 |
Q |
| |
|
||||| |||||| | ||||||||||| ||||||||||||||||||||| |||||| ||||||||||||||| ||||||||||||| ||||||| |||||| |
|
|
| T |
5595305 |
ccattacggccataagcactaatcatagccgaaaaggaatacacagtgtttccatgcccttcaagcctagcactttcaaacaatctcaaagcatgattaa |
5595404 |
T |
|
| Q |
130 |
tctcccctaacctaccaagagtgccaatcatagcactaactaacttgcctttatcaaccctcccat |
195 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||| || ||| ||| |||||||| |
|
|
| T |
5595405 |
tctcccctaacctaccaagagtaccaatcatagtactaactaacttacccttagcaatcctcccat |
5595470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University