View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5524-Insertion-6 (Length: 526)
Name: NF5524-Insertion-6
Description: NF5524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5524-Insertion-6 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 511; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 511; E-Value: 0
Query Start/End: Original strand, 8 - 526
Target Start/End: Original strand, 169901 - 170419
Alignment:
| Q |
8 |
gaaaagacagggattccgtttcttcctactccaatggggaagggattgttgccggatgatcatccgttggctgcctccgcggctaggtcacttgctattg |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
169901 |
gaaaagacggggattccgtttcttcctactccaatggggaagggattgttgccggatgatcatccgttggctgcctccgcggctaggtcacttgctattg |
170000 |
T |
|
| Q |
108 |
gaaaatgtgatgtggcgattgtgattggtgcgaggttgaattggctgcttcattttggggaagagccgaaatggtctaaagatgtaaagtttgtgttggt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
170001 |
gaaaatgtgatgtggcgattgtgattggtgcgaggttgaattggctgcttcattttggggaagagccgaaatggtctaaagatgtaaagtttgtgttggt |
170100 |
T |
|
| Q |
208 |
ggatgtgagcaaggaagaaattgagcttagaaaaccgtttttaggtttagttggtgatggtaaagaagttttggaggttttgaataaggagattaaagat |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
170101 |
ggatgtgagcaaggaagaaattgagcttagaaaaccgtttttagggttagttggtgatggtaaagaagttttggaggttttgaataaggagattaaagat |
170200 |
T |
|
| Q |
308 |
gatccgttttgcttggggagcactcatccatgggtggaagctatttcgagcaaagtgaaggacaatggtgtgaagatggaggctcaattggcgaaggatg |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
170201 |
gatccgttttgcttggggagcactcatccatgggtggaagctatttcgagcaaagtgaaggacaatggtgtgaagatggaggctcaattggcgaaggatg |
170300 |
T |
|
| Q |
408 |
ttgtgccgtttaattttttgacgccgatgaggattatcagagatgctatttcggaatttggaggaagtccggctcctgtggtggtttctgaaggtgctaa |
507 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
170301 |
ttgtgccgtttaattttttgacgccgatgaggattatcagagatgctatttcggaatttggaggaagtccggctcctgtggtggtttctgaaggtgctaa |
170400 |
T |
|
| Q |
508 |
tactatggatgttggtcga |
526 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
170401 |
tactatggatgttggtcga |
170419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University