View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5524_low_3 (Length: 306)
Name: NF5524_low_3
Description: NF5524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5524_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 198 - 295
Target Start/End: Complemental strand, 18328840 - 18328743
Alignment:
| Q |
198 |
taaacatagggggattattgtacattttaaaacaagcaacacttatctctatccgctatttctcatcttgttttctcttctcgcactctgttacctat |
295 |
Q |
| |
|
||||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18328840 |
taaacatagaggtattattgtacatttaaaaacaagcaacacttatctctatccgctatttctcattttgttttctcttctcgcactctgttacctat |
18328743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University