View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5524_low_6 (Length: 220)
Name: NF5524_low_6
Description: NF5524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5524_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 42225389 - 42225209
Alignment:
| Q |
19 |
ccaacatggataatactaacaaaaatgttatgagtattttgagagagag--aaaagcatattgacctacaattatgtttttgt----nnnnnnnnnnnnn |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42225389 |
ccaacatggataatactaacaaaaatgttatgagtattttgagagagagaaaaaagcatattgacctacaattatgtttttgtataaaaagaaaaaaaga |
42225290 |
T |
|
| Q |
113 |
nnnnccatataattatgttcactgaaataccatttcatcattatatttatatataccagttgatgaacatatgatggtggggttcat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42225289 |
aaaaccatataattatgttcactgaaataccatttcatca------ttatatataccagttgatgaacatatgatggtggggttcat |
42225209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University