View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5525-Insertion-7 (Length: 91)
Name: NF5525-Insertion-7
Description: NF5525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5525-Insertion-7 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 59; Significance: 1e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 28333863 - 28333780
Alignment:
| Q |
8 |
tttaatccctgcaaaagggaaattctaggtttcttcagcgtttttgtgatgannnnnnnctactctagttatacttgaacaaca |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28333863 |
tttaatccctgcaaaagggaaattctaggtttcgtcagcgtttttgtgatgatttttttctactctagttatacttgaacaaca |
28333780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University