View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5527_high_11 (Length: 267)
Name: NF5527_high_11
Description: NF5527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5527_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 37 - 253
Target Start/End: Complemental strand, 4503627 - 4503411
Alignment:
| Q |
37 |
tattccagtaatgatacaacctgggttctctcaaaagattgttctttaattgaagttcattaatatcttgatctcaatcttagttgtaggtgtgaattca |
136 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4503627 |
tattccagtaatgatacaacttgggttctctcaaaagattgttctttaattgaatttcattaatatcttgatctcaatcttagttgtaggtgtgaattca |
4503528 |
T |
 |
| Q |
137 |
cttagctcacaaaacctaagataaatttaggtcaatcaatttgtgagtaactttataactatttaattcacgaatacatataaagtttgaaggggttatc |
236 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4503527 |
cttagctcataaaacctaagataaatttaggtcaatcaatatgtgagttactttataactatttaattcacgaatacatataaagtttgaaggggttatc |
4503428 |
T |
 |
| Q |
237 |
taatatagacccggtcc |
253 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
4503427 |
taatatagacccggtcc |
4503411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 4503935 - 4503903
Alignment:
| Q |
1 |
tttggaggtacgattaaagtttgaccaatacgt |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4503935 |
tttggaggtacgattaaagtttgaccaatacgt |
4503903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University