View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5529-Insertion-8 (Length: 127)
Name: NF5529-Insertion-8
Description: NF5529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5529-Insertion-8 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 5e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 5e-60
Query Start/End: Original strand, 11 - 127
Target Start/End: Original strand, 20153773 - 20153889
Alignment:
| Q |
11 |
ccccccttctctttcgcggtttcgtaccgaattcgatactttcaaacgcgccatttctattatattctattggattggatctcggaaagtgatatataca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20153773 |
ccccccttctctttcgcggtttcgtaccgaattcgatactttcaaacgcgccatttctattatattctattggattggatctcggaaagtgatatataca |
20153872 |
T |
 |
| Q |
111 |
ttttacttttttcttct |
127 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
20153873 |
ttttacttttttcttct |
20153889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University