View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5530_low_1 (Length: 295)
Name: NF5530_low_1
Description: NF5530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5530_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 32 - 280
Target Start/End: Complemental strand, 30136169 - 30135919
Alignment:
| Q |
32 |
aactttagctttgactcaacattttgcagctcaaaaactgttgctgcagggtgtttcacaaccatttttcataggattagagagtttcattcaaagttca |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30136169 |
aactttagctttgactcaacattttgcagctcaaaaactgttgctgcagggtgtttcacaaccatttttcataggattagagagtttcattcaaagttca |
30136070 |
T |
 |
| Q |
132 |
ttgtaagtgaaaaagttcaaaaatttaagactaacactcctactactacaagaactataatttcttcttcttc---ttctggtgtagttgcaaggttaat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30136069 |
ttgtaagtgaaaaagttcaaaaatttaagactaacactcctactactacaagaactataatttcttcttcttcttcttctggtgtagttgcaaggttaat |
30135970 |
T |
 |
| Q |
229 |
gggattggattcaatggaagaagagaaagtttctgaatcaaaaccaagttca |
280 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30135969 |
gggatt-gattcaatggaagaagataaagtttctgaatcaaaaccaagttca |
30135919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University