View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5531_high_1 (Length: 301)
Name: NF5531_high_1
Description: NF5531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5531_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 19 - 292
Target Start/End: Original strand, 48123361 - 48123634
Alignment:
| Q |
19 |
aaatggaggctgataagtatcctccaagtcttgctttgtcacctgcaaaaatctccgtaaatatctacatggtgatatatgattggatgcagttgtaaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48123361 |
aaatggaggctgataagtatcctccaagtcttgctttgtcacctgcgaaaatctccgtaaatatctacatggtgatatatgattggatgcagttgtaaaa |
48123460 |
T |
 |
| Q |
119 |
aatatttaacacgttcggtgatagttaagtcattctgtcataatgatccaattgcttatgcatttttggcagcatattaaatttcatggcctaattttgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48123461 |
aatatttaacacgttcggtgatagttaagttattctgtcataatgatccaattgcttatgcatttttggcagcatattaaatttcatggtctaattttgt |
48123560 |
T |
 |
| Q |
219 |
tatcttaattaccttagcatcaaaatggaaccgatcaacgcctttccaattatcaacatcataagcagtataat |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48123561 |
tatcttaattaccttagcatcaaaatggaaccgatcaacgcctttccaattatcaacatcataagcagtataat |
48123634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University