View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5532-Insertion-7 (Length: 265)
Name: NF5532-Insertion-7
Description: NF5532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5532-Insertion-7 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 7 - 265
Target Start/End: Complemental strand, 28303443 - 28303181
Alignment:
| Q |
7 |
aaaagtttcaaaatctttcttatcaggcaagaaaagaaaataaccctatttagtttaagaaaaccattttgaacagcagattggaattaatgagatgtat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
28303443 |
aaaagtttcaaaatctttcttatcaggcaagaaaagaaaataaccctatttagtttaagaaaaccattttgaacagcagattggaattaatgagatgcat |
28303344 |
T |
 |
| Q |
107 |
gcttactcttgcagaatgagatgcttgtcatctatttctcaaaaatgcaaatttattaaaatttatataatttttcaatcaaggtagtcatt----gtaa |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
28303343 |
gcttactcttgcagaatgagatgcttgtcatctatttctcaaaaatgcaaatttattaaaatttatataatttttcaatcaaggtgactattgtaagtaa |
28303244 |
T |
 |
| Q |
203 |
gaccacatcagtgattccatatttgttttttaaggctcgttatagtgttatacaatggtagta |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28303243 |
gaccacatcagtgattccatatttgttttttaaggctcgttatagtgttatacaatggtagta |
28303181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University