View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5532_high_2 (Length: 231)
Name: NF5532_high_2
Description: NF5532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5532_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 215
Target Start/End: Complemental strand, 33169527 - 33169328
Alignment:
| Q |
17 |
atgaaaataagcggtgagactagttgataacatggctacccctgttaaaatatgagtggcctcatttatttgtcttcttttaaatcaaccttaaagtttg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33169527 |
atgaaaataagcggtgagactagttgataacatggctacccctgttaaaatatgagtggcctcatttgtttgtcttcttttaaatcaaccttaaagtttg |
33169428 |
T |
 |
| Q |
117 |
taaactgagcggcaaagaacttcctacaaattgtgataacataaccaagttctataacatcaatctgattcagt-aaggcatttgttggggttttgcaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33169427 |
taaactgagcggcaaagaacttcctacaaattgtgataacataaccaagttctataacatcaatctgattcagtgaaggcatttgttggggttttgcaat |
33169328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University