View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5533_high_2 (Length: 278)
Name: NF5533_high_2
Description: NF5533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5533_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 32001378 - 32001594
Alignment:
| Q |
1 |
tttataacaagtatattacaatttagggttttgaagtctataaattagggtttgatatgaaatcaaatgtagatgcagttagagaagtttatgtaaatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32001378 |
tttataacaagtatattacaatttagggttttgaagtctataaattagggtttgatatgaaatcaaatgtagatgcagttagagaagtttatgtaaatcc |
32001477 |
T |
 |
| Q |
101 |
agtaatattttatggtttaaaatgaggtgtactgtgtcttgatgagatttatgatttttcacttgttgcagaaaattcaaccagtaaacactcaactata |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32001478 |
agtaatattttatggcttaaaatgaggtgtactgtgtcttgatgagatttatgatttttcacttgttgcagaaaattcaaccagtaaacactcaactata |
32001577 |
T |
 |
| Q |
201 |
caaagtatataattatt |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
32001578 |
caaagtatataattatt |
32001594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University