View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5533_low_4 (Length: 231)
Name: NF5533_low_4
Description: NF5533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5533_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 17 - 227
Target Start/End: Complemental strand, 17435005 - 17434795
Alignment:
| Q |
17 |
agctgcatcaactgtgttaatttagttgtgtgactgcgatttaaaaaatcttcatattgtatttaaaatcatgattgtgcatttgttctcaaactatgta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17435005 |
agctgcatcaactgtgttaatttagttgtgtgactgcgatttaaaaaatcttcatattgtatttaaaatcatgattgtgcatttgttctcaaactatgta |
17434906 |
T |
 |
| Q |
117 |
gtgattgagattttgtattttgctaacagatcaacatgtttgtacctagagatttcttactttcacttgcaatacttgtgttgttattaagcacaccatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17434905 |
gtgattgagattttgtattttgctaacagatcaacatgtttgtacctagagatttcttactttcacttgcaatacttgtgttgttattaagcacaccatg |
17434806 |
T |
 |
| Q |
217 |
ctcaagttcat |
227 |
Q |
| |
|
||||||||||| |
|
|
| T |
17434805 |
ctcaagttcat |
17434795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 153 - 225
Target Start/End: Complemental strand, 17455972 - 17455900
Alignment:
| Q |
153 |
tgtttgtacctagagatttcttactttcacttgcaatacttgtgttgttattaagcacaccatgctcaagttc |
225 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
17455972 |
tgtttgtacctagagattttgtactttcacttgccatacttgtggtgttattaagcacaccatgctcaagttc |
17455900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University