View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5535-Insertion-2 (Length: 132)
Name: NF5535-Insertion-2
Description: NF5535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5535-Insertion-2 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 9e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 9e-65
Query Start/End: Original strand, 8 - 132
Target Start/End: Original strand, 34893563 - 34893687
Alignment:
| Q |
8 |
ccaagttccagcatgttggcgaacaataacttcttcggaggctcccaaatttttctcttggtctgatgcattagaactttgtgggagtatatgaacatca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34893563 |
ccaagttccagcatgttggcgaacaataacttcttcggaggctcccaaatttttctcttggtctgatgcattagaactttgtgggagtatatgaacatca |
34893662 |
T |
 |
| Q |
108 |
aatattccttgctctgcatctccat |
132 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
34893663 |
aatattccttgctctgcatctccat |
34893687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University