View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5536-Insertion-7 (Length: 255)
Name: NF5536-Insertion-7
Description: NF5536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5536-Insertion-7 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 8 - 255
Target Start/End: Complemental strand, 29194112 - 29193865
Alignment:
| Q |
8 |
attatcataattgaaaaaatatattaattannnnnnngttatgtcatttcatacttcctgaactctgcatatccgggagctttcgttcgcctggctgccc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| ||||||||| ||| |||||||||||| |
|
|
| T |
29194112 |
attatcataattgaaaaaatatattaattatttttttgttatgtcatttcatacttcctgaagtctgcatatctgggagctttagtttgcctggctgccc |
29194013 |
T |
 |
| Q |
108 |
nnnnnnnnnnngttgtcatttcatacttatcaactaatttcaatcgtaaattttagcaaatactacaagttcaatatgctaaactatccattattcgttg |
207 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29194012 |
tttttttttttgttgtcatttcatatttatcaactagtttcaatcgtaaaatttagcaaatactacaagttcaatatgctaaactagccattattcgttg |
29193913 |
T |
 |
| Q |
208 |
taagttgatccgcaatcagctagtttctcagctatcaatggcctttta |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29193912 |
taagttgatccgcaatcagctagtttctcagctatcaatggcctttta |
29193865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University