View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5539_high_11 (Length: 402)
Name: NF5539_high_11
Description: NF5539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5539_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 1e-41; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 222 - 312
Target Start/End: Original strand, 6706825 - 6706915
Alignment:
| Q |
222 |
agagaactaagaatcagaacaaaaatcaagagaactaaaacgaaaagtaagaatttttataggataagaaaaatatttaagcctaaataga |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6706825 |
agagaactaagaatcagaacaaaaatcaagagaactaaaacgaaaagtaagaatttttatagggtaagaaaaatatttaagcctaaataga |
6706915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 6706608 - 6706669
Alignment:
| Q |
1 |
gtacattatagaattctattttccaaatgnnnnnnnaacaatggatgaactaaatatgaact |
62 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6706608 |
gtacattatagaattctcttttccaaatgttttcttaacaatggatgaactaaatatgaact |
6706669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 53 - 109
Target Start/End: Complemental strand, 41767038 - 41766982
Alignment:
| Q |
53 |
aatatgaacttttacgttttttatgcttgaaaattcatgtttcgttaaaaaattcta |
109 |
Q |
| |
|
|||||||| |||||| ||||||| | || ||||||||| ||| |||||||||||||| |
|
|
| T |
41767038 |
aatatgaatttttacattttttacggttaaaaattcatattttgttaaaaaattcta |
41766982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 51 - 90
Target Start/End: Complemental strand, 19149295 - 19149256
Alignment:
| Q |
51 |
taaatatgaacttttacgttttttatgcttgaaaattcat |
90 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
19149295 |
taaatatgaacttttatgttttttatgcttaaaaattcat |
19149256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University