View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5539_high_13 (Length: 396)
Name: NF5539_high_13
Description: NF5539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5539_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 16 - 382
Target Start/End: Complemental strand, 42485075 - 42484709
Alignment:
| Q |
16 |
aaaccaacccaccatcgactagagccggcaaattctactaatactccgttattaacaacatcaccaataattgcccgtcgtgcaggaatgggcccgggta |
115 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42485075 |
aaaccaacccaccaacgactagagccggcaaattctactaatactccgttattaacaacatcaccaataattgcccgtcgtgcaggaatgggcccgggta |
42484976 |
T |
|
| Q |
116 |
ttggtccaggcccatttataatagcaatgtagacatctccatctaatcttgcgaaggcgagagtagagcttccaattaaaattcccgaaacggattgtga |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
42484975 |
ttggtccaggcccatttataatagcaatgtagacatctccatctaatctcgcgaaggcgagagtagagcttccaattacaattcctgaaacggattgtga |
42484876 |
T |
|
| Q |
216 |
gaacgggccaaatagaagaccatggttggaccaaaatgtgctaacatgtgcaccggtggggagatcgaagagtcggacactaccgtcgacgaagccacag |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42484875 |
gaacgggccaaatagaagaccatggttggaccaaaatgtgctaacatgtgcaccggtgtggagatcgaagagtcggacactaccgtcgacgaagccacag |
42484776 |
T |
|
| Q |
316 |
gcgaggtgggtgtcggagagagtgaggcagcggcagatgaggttttggtggtgatctcctggatcat |
382 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42484775 |
gcaaggtgggtgtcggagagagtgaggcagcggcagatgaggttttggtggtgatctcctggatcat |
42484709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University