View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5539_high_14 (Length: 380)
Name: NF5539_high_14
Description: NF5539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5539_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 18 - 116
Target Start/End: Complemental strand, 27163277 - 27163179
Alignment:
| Q |
18 |
aagaatatcgctatgaagattcttagagaaacttgcgagagataaaatgagcaaaatgatctgatatagagcctagacttgttgtgacgcaccctaacc |
116 |
Q |
| |
|
||||||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27163277 |
aagaatatctctctgaagattcttagagaaacttgtgagagataaaatgagcaaaatgatctgatatagagcctagacttgttgtgacgcaccctaacc |
27163179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 289 - 348
Target Start/End: Complemental strand, 27163010 - 27162951
Alignment:
| Q |
289 |
acaaagaaaaaacagataaagttacatgcttgattaaattgccataaaaatgtgaaaaat |
348 |
Q |
| |
|
||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27163010 |
acaaagaaaaagtagataaaattatatgcttgattaaattgccataaaaatgtgaaaaat |
27162951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 116
Target Start/End: Complemental strand, 48706246 - 48706161
Alignment:
| Q |
32 |
gaagattcttagagaaact-tgcgagagataaaatgagcaaaatgatctgatatagagcctagacttgttgtgacgcaccctaacc |
116 |
Q |
| |
|
|||| ||||||||||| || || |||| |||||||||||||||| |||||||||||| |||||| || ||||| || ||||||| |
|
|
| T |
48706246 |
gaaggttcttagagaacctgtgagagaagtaaaatgagcaaaatgttctgatatagagtctagacctgccgtgacacatcctaacc |
48706161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University