View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5539_high_19 (Length: 359)
Name: NF5539_high_19
Description: NF5539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5539_high_19 |
 |  |
|
| [»] scaffold1004 (1 HSPs) |
 |  |  |
|
| [»] scaffold0760 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1004 (Bit Score: 180; Significance: 4e-97; HSPs: 1)
Name: scaffold1004
Description:
Target: scaffold1004; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 145 - 343
Target Start/End: Complemental strand, 3458 - 3259
Alignment:
| Q |
145 |
attcgtaacaggtacaggcgtacaacgatggaaaggggtaattagatgatgacgt-aaaatggcaaattgggaggaaatatgtattctgattcttttgct |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
3458 |
attcgtaacaggtacaggcgtacaacgatggaaaggggtaattagatgatgacgggaaaatggcaaattgcgaggaaatacgtattctgattcttttgct |
3359 |
T |
 |
| Q |
244 |
gtaaactggtgcaagattttgttctgtcaaacatgctgctgacctttctgcaaacttataacgcgattttggcagggtctttcatcctcagattattcat |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3358 |
gtaaactggtgcaagattttgttctgtcaaacatgctgctgacctttctgcaaacttataacgcgattttggcagggtctttcatcctcagattattcat |
3259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0760 (Bit Score: 180; Significance: 4e-97; HSPs: 1)
Name: scaffold0760
Description:
Target: scaffold0760; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 145 - 343
Target Start/End: Complemental strand, 5953 - 5754
Alignment:
| Q |
145 |
attcgtaacaggtacaggcgtacaacgatggaaaggggtaattagatgatgacgt-aaaatggcaaattgggaggaaatatgtattctgattcttttgct |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
5953 |
attcgtaacaggtacaggcgtacaacgatggaaaggggtaattagatgatgacgggaaaatggcaaattgcgaggaaatacgtattctgattcttttgct |
5854 |
T |
 |
| Q |
244 |
gtaaactggtgcaagattttgttctgtcaaacatgctgctgacctttctgcaaacttataacgcgattttggcagggtctttcatcctcagattattcat |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5853 |
gtaaactggtgcaagattttgttctgtcaaacatgctgctgacctttctgcaaacttataacgcgattttggcagggtctttcatcctcagattattcat |
5754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University