View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5539_high_40 (Length: 237)
Name: NF5539_high_40
Description: NF5539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5539_high_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 55 - 223
Target Start/End: Complemental strand, 38803275 - 38803107
Alignment:
| Q |
55 |
tacatatgttattagttatgtaatttattttgtcaaattttttagtcttcgttnnnnnnnnnnnnntttagccccactaataattcaataccggatccgc |
154 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
38803275 |
tacatatgctattagttatgtaatttattttgtcaaattttttagtcttccttaaaaaaataaaaatttagccccactaataattcaataccggatccgc |
38803176 |
T |
 |
| Q |
155 |
ccctgttagaaagtgtgatattttgttgatatcaagagtgtattggtagcaatattcattggttttctt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38803175 |
ccctgttagaaagtgtgatattttgttgatatcaagagtgtattggtagcaatattcattggttttctt |
38803107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 103
Target Start/End: Complemental strand, 5910059 - 5910002
Alignment:
| Q |
46 |
tacgattaatacatatgttattagttatgtaatttattttgtcaaattttttagtctt |
103 |
Q |
| |
|
|||||||||||||||| || ||| || || |||||||||||||||| ||||||||||| |
|
|
| T |
5910059 |
tacgattaatacatattttgttatttgtgcaatttattttgtcaaaatttttagtctt |
5910002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 103
Target Start/End: Complemental strand, 16671023 - 16670969
Alignment:
| Q |
49 |
gattaatacatatgttattagttatgtaatttattttgtcaaattttttagtctt |
103 |
Q |
| |
|
|||| |||||||| |||||| || |||||||||||| | |||||||||||||||| |
|
|
| T |
16671023 |
gattgatacatatattattatttgtgtaatttatttcgccaaattttttagtctt |
16670969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 159
Target Start/End: Original strand, 15151289 - 15151327
Alignment:
| Q |
121 |
tttagccccactaataattcaataccggatccgcccctg |
159 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
15151289 |
tttagccccactaataattcaatcccagatccgcccctg |
15151327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 103
Target Start/End: Complemental strand, 50661232 - 50661178
Alignment:
| Q |
49 |
gattaatacatatgttattagttatgtaatttattttgtcaaattttttagtctt |
103 |
Q |
| |
|
|||||||||||||||| || || |||||||||||||| |||| ||||||||||| |
|
|
| T |
50661232 |
gattaatacatatgttgctatttttgtaatttattttgccaaaatttttagtctt |
50661178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 103
Target Start/End: Complemental strand, 50677854 - 50677800
Alignment:
| Q |
49 |
gattaatacatatgttattagttatgtaatttattttgtcaaattttttagtctt |
103 |
Q |
| |
|
|||||||||||||||| || || |||||||||||||| |||| ||||||||||| |
|
|
| T |
50677854 |
gattaatacatatgtttatatttttgtaatttattttgccaaaatttttagtctt |
50677800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 47 - 100
Target Start/End: Original strand, 11779008 - 11779061
Alignment:
| Q |
47 |
acgattaatacatatgttattagttatgtaatttattttgtcaaattttttagt |
100 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||| | ||||||||||||| |
|
|
| T |
11779008 |
acgattaatacatatgttatttttttggtaatttatttcgacaaattttttagt |
11779061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University