View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5539_low_26 (Length: 311)
Name: NF5539_low_26
Description: NF5539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5539_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 297
Target Start/End: Original strand, 48861822 - 48862109
Alignment:
| Q |
1 |
aacaacaagattatgaaacgttctggtagctcttctagcctctcacatcatggcaagtcccctacctgggtaagcttcaacccttttttcattcaaggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48861822 |
aacaacaagattatgaaacgttctggtagctcttctagcctctcacatcatggcaagtcccctacctgggtaagcttcaacccttttttcattcaaggtt |
48861921 |
T |
|
| Q |
101 |
tcaactttctactagtgtttttgtgtttgtctccaaagttgtgacttttgtctcatggaattgcatatgttatannnnnnnnnnnnnnnnnnnaaattca |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48861922 |
tcaactttctactagtttttttgtgtttgtctccaaagttgtgacttttgtctcatggaattgcatatgttata---------attattattaaaattca |
48862012 |
T |
|
| Q |
201 |
aatggtctattaattttgcatttgcagacaactatccgtaaggggatgaagcaggtggttacacttccatggaggagcaaaaagttgaagaagaaag |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48862013 |
aatggtctattaattttgcatttgcagacaactatccgtaaggggatgaagcaggtggttacactaccatggaggagcaaaaagttgaagaagaaag |
48862109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University