View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5539_low_27 (Length: 300)
Name: NF5539_low_27
Description: NF5539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5539_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 16 - 293
Target Start/End: Original strand, 320891 - 321168
Alignment:
| Q |
16 |
agaagctacttggatttggtgcaaataaccatgatcatggttttagagctgaaattcaaacacttggaaacataaggcacagaaacatagtaaggctact |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
320891 |
agaagctacttggatttggtgcaaataaccatgatcatggttttagagctgaaattcaaacacttggaaacataaggcacagaaacatagtaaggctact |
320990 |
T |
|
| Q |
116 |
tgcattctgttcaaacaaagaaacaaatctgctcgtgtacgaatacatgagaaatggaagcttaggtgagacattgcatgggaaaaaaggtgcattcttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
320991 |
tgcattctgttcaaacaaagaaacaaatctgctcgtgtacgaatacatgagaaatggaagcttaggtgagacattgcatgggaaaaaaggtgcattcttg |
321090 |
T |
|
| Q |
216 |
agttggaactttaggtacaaaatttcaattgattcggcgaaaggactctgctaccttcaccatgattgttctcctttg |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
321091 |
agttggaactttaggtacaaaatttcaattgattcggcgaaaggactctgctaccttcaccatgattgttctcctttg |
321168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University