View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5539_low_38 (Length: 251)
Name: NF5539_low_38
Description: NF5539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5539_low_38 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 38 - 222
Target Start/End: Original strand, 26262156 - 26262343
Alignment:
| Q |
38 |
gttgaaggaagacgatgtaggacttaaccactcacatttaaaactcaacagttttattcgaagacgagcaaa----taatgttgttgatctattaatcaa |
133 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| | |||| ||||||||||||||||||| |||| |
|
|
| T |
26262156 |
gttgaaggaagacgatgtggaacttaaccactcacatttaaaactcaacagttttattcgaagaaaaacaaataattaatgttgttgatctattagtcaa |
26262255 |
T |
|
| Q |
134 |
agagatatcgtggtacacgtgtttctaaattcaagagcatatatcactttgtatttatgattgcagttataagtgaaattaattagttg |
222 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| ||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26262256 |
agagatatcgtggtacacatgtttctaaattcaagagcatatatcatttttta-ttatgattgcagttataagtgaaattaattagttg |
26262343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University