View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5539_low_49 (Length: 203)
Name: NF5539_low_49
Description: NF5539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5539_low_49 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 44 - 181
Target Start/End: Complemental strand, 19198256 - 19198119
Alignment:
| Q |
44 |
ggaaacctgaccctcaaagagagactacaacaggatcaaacaatggggagacaagtgcatatgtattggatgaaactttgatcgacaagatcaaacaatg |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| ||||| ||||||||||||||||| |||| |
|
|
| T |
19198256 |
ggaaacctgaccctcaaagagagactacaacaggatcaaacaatggggagacaagtgcagatgtatgggagaaaactgtgatcgacaagatcaaataatg |
19198157 |
T |
|
| Q |
144 |
ggcaaatatacaggagagaactgagcccgacaagatca |
181 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
19198156 |
ggcagataaacaggagagaactgagcccgacaagatca |
19198119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 35 - 102
Target Start/End: Complemental strand, 19202207 - 19202140
Alignment:
| Q |
35 |
agactacagggaaacctgaccctcaaagagagactacaacaggatcaaacaatggggagacaagtgca |
102 |
Q |
| |
|
||||| ||| |||||||| ||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19202207 |
agacttcagagaaacctggccctctaagacagactacaacaggatcaaacaatggggagacaaatgca |
19202140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University