View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5540-Insertion-15 (Length: 60)
Name: NF5540-Insertion-15
Description: NF5540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5540-Insertion-15 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 54; Significance: 8e-23; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 7 - 60
Target Start/End: Original strand, 43091193 - 43091246
Alignment:
| Q |
7 |
atcaacattgttcctttttccatctccaacaccctactactacctaatacatac |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091193 |
atcaacattgttcctttttccatctccaacaccctactactacctaatacatac |
43091246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University