View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5540_high_11 (Length: 230)
Name: NF5540_high_11
Description: NF5540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5540_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 25 - 211
Target Start/End: Original strand, 42801683 - 42801869
Alignment:
| Q |
25 |
tatacattgttttatttatagtcttggtctacctcttcccttgttaagtcatatatttgacttcgaattattggattttttctctcgattagatgttagg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| | |
|
|
| T |
42801683 |
tatacattgttttatttatagtcttggtctacctcttcccttgttaagtcatatatttgacttcgaattattggattttttccctcgtttagatgttatg |
42801782 |
T |
 |
| Q |
125 |
atatatatgtgatttgggagtgatcattgtggatattctctgagtatgccggaacctttagtcttatttgtgtgacatattgtcatc |
211 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42801783 |
atgtatatgtgatttgggagtgatcattgtggatattctctgagtatgccggaacctttagtcttatttgtgtgacatattgtcatc |
42801869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University