View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5540_low_10 (Length: 263)

Name: NF5540_low_10
Description: NF5540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5540_low_10
NF5540_low_10
[»] chr6 (3 HSPs)
chr6 (169-243)||(4142240-4142314)
chr6 (29-85)||(4141824-4141880)
chr6 (83-125)||(4141956-4141998)
[»] chr5 (1 HSPs)
chr5 (29-85)||(3854777-3854833)


Alignment Details
Target: chr6 (Bit Score: 51; Significance: 3e-20; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 169 - 243
Target Start/End: Original strand, 4142240 - 4142314
Alignment:
169 acttattttctatatgacagtgctgctcatgctgcagctggtctctttatggtaccgttgtctactttgtgttct 243  Q
    |||| ||||||||||||||||||||||| || ||||||||||||||||||||||| | |||| ||||||||||||    
4142240 acttgttttctatatgacagtgctgctcgtgttgcagctggtctctttatggtactgatgtcgactttgtgttct 4142314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 4141824 - 4141880
Alignment:
29 ggaggaggaggctatggattaagcggcaatgatcataattcattgcatccacaattt 85  Q
    ||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||    
4141824 ggaggagtaggttatggattaagcggcgatgatcataattcattgcatccacaattt 4141880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 83 - 125
Target Start/End: Original strand, 4141956 - 4141998
Alignment:
83 tttacagaaataagctgctccgaatgatcgaagaattacactt 125  Q
    ||||||||||||||| ||||| ||||||| |||||||||||||    
4141956 tttacagaaataagcagctccaaatgatcaaagaattacactt 4141998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 3854833 - 3854777
Alignment:
29 ggaggaggaggctatggattaagcggcaatgatcataattcattgcatccacaattt 85  Q
    ||||||||||||||||||| |||||   |||||||||||||||||||||||||||||    
3854833 ggaggaggaggctatggatcaagcgttgatgatcataattcattgcatccacaattt 3854777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University