View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5540_low_10 (Length: 263)
Name: NF5540_low_10
Description: NF5540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5540_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 51; Significance: 3e-20; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 169 - 243
Target Start/End: Original strand, 4142240 - 4142314
Alignment:
| Q |
169 |
acttattttctatatgacagtgctgctcatgctgcagctggtctctttatggtaccgttgtctactttgtgttct |
243 |
Q |
| |
|
|||| ||||||||||||||||||||||| || ||||||||||||||||||||||| | |||| |||||||||||| |
|
|
| T |
4142240 |
acttgttttctatatgacagtgctgctcgtgttgcagctggtctctttatggtactgatgtcgactttgtgttct |
4142314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 4141824 - 4141880
Alignment:
| Q |
29 |
ggaggaggaggctatggattaagcggcaatgatcataattcattgcatccacaattt |
85 |
Q |
| |
|
||||||| ||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4141824 |
ggaggagtaggttatggattaagcggcgatgatcataattcattgcatccacaattt |
4141880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 83 - 125
Target Start/End: Original strand, 4141956 - 4141998
Alignment:
| Q |
83 |
tttacagaaataagctgctccgaatgatcgaagaattacactt |
125 |
Q |
| |
|
||||||||||||||| ||||| ||||||| ||||||||||||| |
|
|
| T |
4141956 |
tttacagaaataagcagctccaaatgatcaaagaattacactt |
4141998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 3854833 - 3854777
Alignment:
| Q |
29 |
ggaggaggaggctatggattaagcggcaatgatcataattcattgcatccacaattt |
85 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3854833 |
ggaggaggaggctatggatcaagcgttgatgatcataattcattgcatccacaattt |
3854777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University