View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5540_low_7 (Length: 355)
Name: NF5540_low_7
Description: NF5540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5540_low_7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 347; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 1 - 355
Target Start/End: Complemental strand, 45791867 - 45791513
Alignment:
| Q |
1 |
ataacatgtatacataaaacaaattatacaccaaggtgtcagattttactttcttcatgctaggttaacccaaaaataggcagtgctttttgaccctttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45791867 |
ataacatgtatacataaaacaaattatacaccaaggtgtcagattttactttcttcatgctaggttaacccaaaaataggcagtgctttttgaccctttg |
45791768 |
T |
|
| Q |
101 |
atttgccccaacaataaacttggataaaagaatatcgcacatctcataattctaccatagaaagatatcacaaatcaatatgactggatccaaatatcac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45791767 |
atttgccccaacaataaacttggataaaagaatatcgcacatctcataattctaccatagaaacatatcacaaatcaatatgactggatccaaatatcac |
45791668 |
T |
|
| Q |
201 |
cgtgagaatgtcacggaagcaattcggggttgccactcgttggctctaacaaccatgttctatatccctcccaagctctctttccacagacacacataaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45791667 |
cgtgagaatgtcacggaagcaattcggggttgccactcgttggctctaacaaccatgttctatatccctcccaagctctctttccacagacacacataaa |
45791568 |
T |
|
| Q |
301 |
atcttcctacactgcaaaggtcgacagtaatcaagagacaaatgatccgctatct |
355 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45791567 |
atcttcctacactgcaaaggtcaacagtaatcaagagacaaatgatccgctatct |
45791513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University