View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5540_low_9 (Length: 309)
Name: NF5540_low_9
Description: NF5540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5540_low_9 |
 |  |
|
| [»] chr2 (32 HSPs) |
 |  |
|
| [»] chr8 (32 HSPs) |
 |  |
|
| [»] chr7 (28 HSPs) |
 |  |
|
| [»] chr5 (23 HSPs) |
 |  |
|
| [»] chr1 (28 HSPs) |
 |  |
|
| [»] chr6 (16 HSPs) |
 |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |
|
| [»] chr3 (28 HSPs) |
 |  |
|
| [»] scaffold0131 (1 HSPs) |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |
|
| [»] scaffold0978 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 6e-31; HSPs: 32)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 18 - 94
Target Start/End: Original strand, 27886328 - 27886404
Alignment:
| Q |
18 |
caaatatcagtcatataacaagtttaaatggtataaattacggagataccttagtagagtggatttcctaccgtgga |
94 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27886328 |
caaatatcagtcatatagcaagtttaaatggtctaaattacggagataccttagtagagtggatttcctaccgtgga |
27886404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 143 - 217
Target Start/End: Original strand, 27886453 - 27886527
Alignment:
| Q |
143 |
atatgttgagatttcaccgggtcctccattcattctagaggattcaatcatgataccttattgcatctacaagag |
217 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27886453 |
atatgttgcgatttcactgggtcctccattcattctagaggattcaatcatgataccttattgcatttacaagag |
27886527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 36955093 - 36955040
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36955093 |
tattttgcgagattttatgcaattttgtgttggttttatgttttggttgatcca |
36955040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 44745673 - 44745620
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44745673 |
tattttgcaagattttatgcaattttgtgtcggttttatgttttggttgatcca |
44745620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 254 - 309
Target Start/End: Original strand, 36584496 - 36584551
Alignment:
| Q |
254 |
tatattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36584496 |
tatattttgcgagattttatgcaattttgtgttagttttatgttttggttgatcca |
36584551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 11651049 - 11650996
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11651049 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
11650996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 13613175 - 13613122
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13613175 |
tattttgcgagattttatgcaattttgtgttggttttatattttggttgatcca |
13613122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 31581833 - 31581780
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31581833 |
tattttgctagattttatgcaattttgtgtcggttttatgttttggttgatcca |
31581780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 41832451 - 41832504
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
41832451 |
tattttgcaagattttatgcaattttatgtcggttttatgttttggttgatcca |
41832504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 43564493 - 43564546
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43564493 |
tattttgcgatattttatgcaattttgtgttggttttatgttttggttgatcca |
43564546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 6755904 - 6755957
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
6755904 |
tattttgcgagattttatgcaattttgtgttgtttttatgtttttgttgatcca |
6755957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 19653727 - 19653674
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19653727 |
tattttgttagattttatgcaattttgtgtcggttttatgttttggttgatcca |
19653674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 40228513 - 40228460
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
40228513 |
tattttgcgagattttatgcaattttgtgtcggttttatgctttggttgatcca |
40228460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 45670035 - 45670088
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| |||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
45670035 |
tattttgcgagattttatgtaattttgtgtcggttttatgttttggttgatcca |
45670088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 259 - 309
Target Start/End: Complemental strand, 2654990 - 2654940
Alignment:
| Q |
259 |
tttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||| ||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
2654990 |
tttgcgagattttatgcaattttgtatcggttttatgttttggttgatcca |
2654940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 267 - 309
Target Start/End: Complemental strand, 44817621 - 44817579
Alignment:
| Q |
267 |
attttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44817621 |
attttatgcaattttgtgtcggttttatgttttggttgatcca |
44817579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 12700651 - 12700598
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
12700651 |
tattttgcgagactttatgcaattttgtgtcgattttatgttttggttgatcca |
12700598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 13233305 - 13233358
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| | ||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
13233305 |
tattttgcgatattttatgcaattttgtatcggttttatgttttggttgatcca |
13233358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 258 - 309
Target Start/End: Complemental strand, 31664248 - 31664197
Alignment:
| Q |
258 |
ttttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||| |||||||||||||||||| || ||||||||| ||||||||||||| |
|
|
| T |
31664248 |
ttttgcgagattttatgcaattttgagtcggttttatgatttggttgatcca |
31664197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 259 - 309
Target Start/End: Original strand, 16925184 - 16925234
Alignment:
| Q |
259 |
tttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||| ||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
16925184 |
tttgcgagactttatgcaattttgtatcggttttatgttttggttgatcca |
16925234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 18491262 - 18491315
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||| |||||||||| |||||| ||| ||||||||||||||||||||||| |
|
|
| T |
18491262 |
tattttgtgagattttatgtaattttatgtcggttttatgttttggttgatcca |
18491315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 44134569 - 44134621
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||| ||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
44134569 |
tattttgtgagattttatgcaatttt-tattggttttatgttttggttgatcca |
44134621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 44134681 - 44134734
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
44134681 |
tattttgcgagattttatacaattttatgtcggttttaggttttggttgatcca |
44134734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 54795812 - 54795759
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||| ||||| |||||||| |
|
|
| T |
54795812 |
tattttgcaagattttatacaattttgtgtcggttttagattttgattgatcca |
54795759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 307
Target Start/End: Original strand, 27270428 - 27270479
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatc |
307 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||||| |||||| |||||| |
|
|
| T |
27270428 |
tattttgcgagattttatacaattttgtgtcggttttaggttttgattgatc |
27270479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 4632788 - 4632735
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| |||||||||||| |||||| ||| |||||||||| |
|
|
| T |
4632788 |
tattttgcgagattttatacaattttgtgttagttttagatttcggttgatcca |
4632735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 6756017 - 6756070
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| | ||||| ||| |||||||||||| |||||||||| |
|
|
| T |
6756017 |
tattttgcgagattttatactattttatgtcggttttatgtttcggttgatcca |
6756070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 13613062 - 13613009
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||| | ||||||||| ||||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
13613062 |
tattttccgagattttatacaattttatgtcggttttaggttttggttgatcca |
13613009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 13857687 - 13857740
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||| |||| || ||||||| |
|
|
| T |
13857687 |
tattttgtgagattttatacaattttgtgttggttttaagtttcggctgatcca |
13857740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 31664137 - 31664084
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||||||||||||| |||||| ||| ||||||| |||| |||||||||| |
|
|
| T |
31664137 |
tattttgcaagattttataaaattttatgtcggttttaggtttcggttgatcca |
31664084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 38141640 - 38141587
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||| | ||||||||||| ||||||||| |
|
|
| T |
38141640 |
tattttgcgagattttatgcaattttgtatcaattttatgtttttgttgatcca |
38141587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 246
Target Start/End: Original strand, 36584419 - 36584451
Alignment:
| Q |
214 |
agagcagtggcggagcctttcatgggctggggt |
246 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
36584419 |
agagcagtggcggagcccttcatgggctggggt |
36584451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 8e-21; HSPs: 32)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 254 - 309
Target Start/End: Original strand, 41699257 - 41699312
Alignment:
| Q |
254 |
tatattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41699257 |
tatattttgcgagattttatgcaattttgtgttggttttatgttttggttgatcca |
41699312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 16194327 - 16194380
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16194327 |
tattttgcgagattttatgcaattttgtgttggttttatgttttggttgatcca |
16194380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 13616046 - 13615993
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13616046 |
tattttgcgagattttatgcaattttgtgttgtttttatgttttggttgatcca |
13615993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 23869738 - 23869791
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23869738 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
23869791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 26293235 - 26293288
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26293235 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
26293288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 34983351 - 34983404
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34983351 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
34983404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 38763789 - 38763842
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38763789 |
tatttagcgagattttatgcaattttgtgttggttttatgttttggttgatcca |
38763842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 42016578 - 42016631
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42016578 |
tattttgtgagattttatgcaattttgtgttggttttatgttttggttgatcca |
42016631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 307
Target Start/End: Original strand, 2249656 - 2249707
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatc |
307 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2249656 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttggttgatc |
2249707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 26860745 - 26860692
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| |||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
26860745 |
tattttgcgagattttatgcaatttcgtgtcggttttatgttttggttgatcca |
26860692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 31392622 - 31392675
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31392622 |
tattttgttagattttatgcaattttgtgtcggttttatgttttggttgatcca |
31392675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 265 - 309
Target Start/End: Complemental strand, 6750080 - 6750036
Alignment:
| Q |
265 |
agattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6750080 |
agattttatgcaattttgtgttggttttatgttttgattgatcca |
6750036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 307
Target Start/End: Complemental strand, 19284013 - 19283962
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatc |
307 |
Q |
| |
|
|||||||| ||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
19284013 |
tattttgcgagattttatgcaattttgtatcggttttatgttttggttgatc |
19283962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 256 - 306
Target Start/End: Original strand, 11764869 - 11764919
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgat |
306 |
Q |
| |
|
|||||||||||||||||| ||| ||||||| |||||||||||||||||||| |
|
|
| T |
11764869 |
tattttgcaagattttatacaactttgtgtcggttttatgttttggttgat |
11764919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 259 - 309
Target Start/End: Original strand, 12995044 - 12995094
Alignment:
| Q |
259 |
tttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||| ||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
12995044 |
tttgcgagattttatgcaattttgtatcggttttatgttttggttgatcca |
12995094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 1021151 - 1021098
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
1021151 |
tattttgcgagattttatacaattttgtgtcggttttatgatttggttgatcca |
1021098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 1115121 - 1115068
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
1115121 |
tattttgcgagattttatacaattttgtgtcggttttatgatttggttgatcca |
1115068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 7366226 - 7366279
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
7366226 |
tattttgcgagattttatgcaattttgtgtgagttttatgttttgcttgatcca |
7366279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 36436265 - 36436212
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| | ||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
36436265 |
tattttgcgatattttatgcaattttgtgtcggttttatgttttgcttgatcca |
36436212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 28745575 - 28745528
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggtt |
303 |
Q |
| |
|
|||||||| ||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
28745575 |
tattttgcgagattttatgcaattttgtgtcgattttatgttttggtt |
28745528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 258 - 309
Target Start/End: Complemental strand, 34494556 - 34494505
Alignment:
| Q |
258 |
ttttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||| ||||||||||||||||||| | ||||||||||||| ||||||||| |
|
|
| T |
34494556 |
ttttgcgagattttatgcaattttgtatcggttttatgtttttgttgatcca |
34494505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 3836423 - 3836370
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||| | ||||||||| ||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
3836423 |
tattttacgagattttatacaattttgtgtcggttttaggttttggttgatcca |
3836370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 11935459 - 11935406
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||||| |||||||||||||| |
|
|
| T |
11935459 |
tattttgcgagattttatacaattttgtgtcggttttagattttggttgatcca |
11935406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 13615933 - 13615880
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
13615933 |
tattttgcgagattttatacaattttatgtcggttttaggttttggttgatcca |
13615880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 22674823 - 22674770
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||| |||| || ||||||| |
|
|
| T |
22674823 |
tattttgcgagattttatgcaattttgtgtcggttttaggtttcggctgatcca |
22674770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 38527249 - 38527302
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||| ||||||||||||||||||| | |||||||||| |||||||||||| |
|
|
| T |
38527249 |
tattttgtgagattttatgcaattttgtatcggttttatgtcttggttgatcca |
38527302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 38763902 - 38763955
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
38763902 |
tattttgcgagattttatacaattttatgtcggttttaggttttggttgatcca |
38763955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 42016691 - 42016744
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
42016691 |
tattttgcgagattttatacaattttatgtcggttttaagttttggttgatcca |
42016744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 43471537 - 43471484
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||||| |||||| |||||||| |
|
|
| T |
43471537 |
tattttgcgagattttatacaattttgtgtcggttttaggttttgattgatcca |
43471484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 44545699 - 44545646
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
44545699 |
tattttgcgagattttatacaattttatgttggttttaagtttcggttgatcca |
44545646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 44545812 - 44545759
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| | ||||||| ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
44545812 |
tattttgcgatattttatacaattttgtgtcggttttatattttggttgatcca |
44545759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 6749976 - 6749923
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| | ||||||| ||||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
6749976 |
tattttgcgatattttatacaattttatgtcggttttaggttttggttgatcca |
6749923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 1e-19; HSPs: 32)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 7242718 - 7242665
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7242718 |
tattttgcgagattttatgcaattttgtgttggttttatgttttggttgatcca |
7242665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 2317137 - 2317190
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2317137 |
tattttgcgagattttatacaattttgtgttggttttatgttttggttgatcca |
2317190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 21434915 - 21434968
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21434915 |
tattttgcgaggttttatgcaattttgtgttggttttatgttttggttgatcca |
21434968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 24797137 - 24797084
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
24797137 |
tattttgcaagattttatgcaattttgtatcggttttatgttttggttgatcca |
24797084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 41838038 - 41837985
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41838038 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
41837985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 42556177 - 42556124
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42556177 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
42556124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 254 - 309
Target Start/End: Original strand, 38567203 - 38567258
Alignment:
| Q |
254 |
tatattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
38567203 |
tatattttgcgagattttatgcaattttgtgttgattttatgtttttgttgatcca |
38567258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 263 - 309
Target Start/End: Original strand, 4697889 - 4697935
Alignment:
| Q |
263 |
caagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4697889 |
caagattttatgcaattttgtgtcggttttatgttttggttgatcca |
4697935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 3886864 - 3886811
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
3886864 |
tattttgcgagattttatgcaattttgtgtcgattttatgttttggttgatcca |
3886811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 5590257 - 5590204
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||| | ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5590257 |
tatttttcgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
5590204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 10092330 - 10092383
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
10092330 |
tattttgcgagattttatgcaattttgtgttggttttttgttttagttgatcca |
10092383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 22658430 - 22658377
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
22658430 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttgattgatcca |
22658377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 28564960 - 28565013
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28564960 |
tattttgcgagattttatgcaattttgtgtcagttttatgttttggttgatcca |
28565013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 28572583 - 28572636
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28572583 |
tattttgcgagattttatgcaattttgtgtcagttttatgttttggttgatcca |
28572636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 43117424 - 43117477
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43117424 |
tattttgcgagattttatacaattttgtgtcggttttatgttttggttgatcca |
43117477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 307
Target Start/End: Original strand, 4231295 - 4231346
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatc |
307 |
Q |
| |
|
|||||| | ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4231295 |
tattttacgagattttatgcaattttgtgtcggttttatgttttggttgatc |
4231346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 254 - 309
Target Start/End: Original strand, 36060431 - 36060486
Alignment:
| Q |
254 |
tatattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36060431 |
tatattttgcgagattttatgcaattttgtgtcaattttatgttttggttgatcca |
36060486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 256 - 306
Target Start/End: Original strand, 1183898 - 1183948
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgat |
306 |
Q |
| |
|
|||||||| ||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
1183898 |
tattttgcgagattttatgcaattttgtatcggttttatgttttggttgat |
1183948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 6316952 - 6317005
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||| ||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
6316952 |
tattttgtgagattttatgcaattttgtgtcgattttatgttttggttgatcca |
6317005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 9830683 - 9830736
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
9830683 |
tattttgcgagattttatgcaactttgtgtcgattttatgttttggttgatcca |
9830736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 41388081 - 41388134
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
41388081 |
tattttgcaagattttatacaattttgtgtcggttttatgatttggtttatcca |
41388134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 3659906 - 3659853
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| | |||| ||||||||||||||| |
|
|
| T |
3659906 |
tattttgcgagattttatgcaattttgtgtcaggtttacgttttggttgatcca |
3659853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 7012413 - 7012466
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| | || |||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
7012413 |
tattttgcgatatcttatgcaattttgtatcggttttatgttttggttgatcca |
7012466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 7242606 - 7242553
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
7242606 |
tattttgcgagattttatacaattttatgtcggttttaggttttggttgatcca |
7242553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 7413107 - 7413160
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||||| |||||| |||||||| |
|
|
| T |
7413107 |
tattttgcgagattttatacaattttgtgtcggttttaggttttgattgatcca |
7413160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 8996424 - 8996477
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||| | ||||||||||||||||||||| ||||||| |||| |||||||||| |
|
|
| T |
8996424 |
tattttacgagattttatgcaattttgtgtcggttttaagtttaggttgatcca |
8996477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 21435028 - 21435081
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
21435028 |
tattttgctagattttatacaattttatgtcggttttaggttttggttgatcca |
21435081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 25642816 - 25642763
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
25642816 |
tattttgcgagattttatataattttgtgtcggttttaggttttggttgatcca |
25642763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 256 - 308
Target Start/End: Complemental strand, 3886751 - 3886699
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcc |
308 |
Q |
| |
|
|||||||| ||||||||| ||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
3886751 |
tattttgcgagattttatacaattttatgtcggttttaggttttggttgatcc |
3886699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 267 - 309
Target Start/End: Original strand, 1098144 - 1098186
Alignment:
| Q |
267 |
attttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
1098144 |
attttatgcaattttgtatcagttttatgttttggttgatcca |
1098186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 7422132 - 7422079
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||||| ||| |||||||||| |
|
|
| T |
7422132 |
tattttgcgagattttatacaattttgtgtcggttttagatttcggttgatcca |
7422079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 17836503 - 17836556
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||| |||||||||| ||||||||||| ||||||| |||| || ||||||| |
|
|
| T |
17836503 |
tattttgtaagattttatacaattttgtgtcggttttaggtttcgggtgatcca |
17836556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 1e-19; HSPs: 28)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 44468104 - 44468051
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44468104 |
tattttgcgagattttatgcaattttgtgttggttttatgttttggttgatcca |
44468051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 9624071 - 9624124
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9624071 |
tattttgcgagattttatgcaattttgtgttggttttatattttggttgatcca |
9624124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 31428812 - 31428865
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
31428812 |
tattttgcaagattttatgcaattttgtgtcggttttatgttttgattgatcca |
31428865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 45350126 - 45350179
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45350126 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
45350179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 46027755 - 46027808
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46027755 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
46027808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 254 - 309
Target Start/End: Original strand, 44142835 - 44142890
Alignment:
| Q |
254 |
tatattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44142835 |
tatattttgcgagattttatgcaattttgtgttggttttatgttttctttgatcca |
44142890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 259 - 309
Target Start/End: Complemental strand, 22723856 - 22723806
Alignment:
| Q |
259 |
tttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22723856 |
tttgcgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
22723806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 17166941 - 17166994
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
17166941 |
tattttgcgagattttatgcaattttgtatcggttttatgttttggttgatcca |
17166994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 23469479 - 23469426
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
23469479 |
tattttgcgagattttatgcaattttgtgtcggttttatattttggttgatcca |
23469426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 26873778 - 26873831
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26873778 |
tattttgcgagattttatacaattttgtgtcggttttatgttttggttgatcca |
26873831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 29075268 - 29075215
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| | ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29075268 |
tattttgcgatattttatgcaattttgtgtcggttttatgttttggttgatcca |
29075215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 36675570 - 36675517
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36675570 |
tattttgtgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
36675517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 265 - 309
Target Start/End: Complemental strand, 42242003 - 42241959
Alignment:
| Q |
265 |
agattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42242003 |
agattttatgcaattttgtgtcggttttatgttttggttgatcca |
42241959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 259 - 309
Target Start/End: Original strand, 39976399 - 39976449
Alignment:
| Q |
259 |
tttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||| ||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
39976399 |
tttgcgagattttatgcaattttgtatcggttttatgttttggttgatcca |
39976449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 259 - 309
Target Start/End: Original strand, 43859169 - 43859219
Alignment:
| Q |
259 |
tttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||| ||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
43859169 |
tttgcgagattttatgcaattttgtatcggttttatgttttggttgatcca |
43859219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 16834360 - 16834307
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||| || ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16834360 |
tattttgtaaaattttatgcaattttgtgtcagttttatgttttggttgatcca |
16834307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 31065706 - 31065653
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||| | ||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
31065706 |
tattttacgagattttatgcaattttgtgtcggttttatgttttggttaatcca |
31065653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 36358393 - 36358340
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| | ||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
36358393 |
tattttgcgacattttatgcaattttgtatcggttttatgttttggttgatcca |
36358340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 40055666 - 40055719
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||| | |||| |||||||||||||||||| |
|
|
| T |
40055666 |
tattttgcgagattttatgcaattttgtatcggttgtatgttttggttgatcca |
40055719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 254 - 298
Target Start/End: Complemental strand, 29502217 - 29502173
Alignment:
| Q |
254 |
tatattttgcaagattttatgcaattttgtgttggttttatgttt |
298 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
29502217 |
tatattttgcaagattttattcaattttgtgttggttttaggttt |
29502173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 307
Target Start/End: Complemental strand, 44724146 - 44724095
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatc |
307 |
Q |
| |
|
||||||| ||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
44724146 |
tattttgagagattttatacaattttgtgtcggttttatgttttggttgatc |
44724095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 18104401 - 18104349
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| |||||| |||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
18104401 |
tattttgcgagattt-atgcaattttgtgtcggtttcatgttttggttgatcca |
18104349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 298
Target Start/End: Original strand, 6961122 - 6961164
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttt |
298 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
6961122 |
tattttgcaagattttatacaattttgtgtcggttttaggttt |
6961164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 259 - 309
Target Start/End: Original strand, 41367737 - 41367787
Alignment:
| Q |
259 |
tttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||| ||||||||||||||||||| | | |||||| |||||||||||||| |
|
|
| T |
41367737 |
tttgcgagattttatgcaattttgtatcgattttatattttggttgatcca |
41367787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 8727797 - 8727850
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| |||||||||| || ||||||| |
|
|
| T |
8727797 |
tattttacaagattttatgtcattttgtgttgattttatgtttcggctgatcca |
8727850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 9624184 - 9624237
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||| | ||||||||| ||||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
9624184 |
tattttccgagattttatacaattttatgtcggttttaggttttggttgatcca |
9624237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 22566663 - 22566610
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||||| |||| || ||||||| |
|
|
| T |
22566663 |
tattttgcgagattttatacaattttgtgtcggttttaagtttcggctgatcca |
22566610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 257 - 309
Target Start/End: Original strand, 25174223 - 25174275
Alignment:
| Q |
257 |
attttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||| ||||||||| |||| ||||||||||||| |||| |||||||||| |
|
|
| T |
25174223 |
attttgcgagattttatataattatgtgttggttttaggtttcggttgatcca |
25174275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 1e-19; HSPs: 23)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 7440563 - 7440510
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7440563 |
tattttgcgagattttatgcaattttgtgttggttttatgttttggttgatcca |
7440510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 43348709 - 43348762
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43348709 |
tattttgcgagattttatgcaattttgtgttggttttatgttttggttgatcca |
43348762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 3631334 - 3631387
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3631334 |
tattttgcgagattttatgcaattttgtgttggttttatgttttagttgatcca |
3631387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 29390344 - 29390397
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29390344 |
tattttacgagattttatgcaattttgtgttggttttatgttttggttgatcca |
29390397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 43358485 - 43358538
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43358485 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
43358538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 307
Target Start/End: Original strand, 15374190 - 15374241
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatc |
307 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15374190 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttggttgatc |
15374241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 307
Target Start/End: Original strand, 16823206 - 16823257
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatc |
307 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16823206 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttggttgatc |
16823257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 256 - 306
Target Start/End: Original strand, 30772954 - 30773004
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgat |
306 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
30772954 |
tattttgcaagattttatgcaattttgtatcggttttatgttttggttgat |
30773004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 9737789 - 9737736
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
9737789 |
tattttgcgagattttatgcaattttgtgtcggttttatgtttttgttgatcca |
9737736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 26525312 - 26525259
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26525312 |
tattttgcgagattttttgcaattttgtgtcggttttatgttttggttgatcca |
26525259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 307
Target Start/End: Complemental strand, 25701503 - 25701452
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatc |
307 |
Q |
| |
|
||||||||||||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
25701503 |
tattttgcaagattttatgtaattttgtatcggttttatgttttggttgatc |
25701452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 8074321 - 8074268
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
8074321 |
tattttgcgagattttatacaattttgtgtcggttttaggttttggttgatcca |
8074268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 9596248 - 9596195
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||| |||| ||||||||| |
|
|
| T |
9596248 |
tattttgcgagattttatgcaattttgtgtcggttttatattttagttgatcca |
9596195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 32304735 - 32304682
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||| | ||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
32304735 |
tattttacgagattttatgcaattttgtgtcggttttatattttggttgatcca |
32304682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 265 - 309
Target Start/End: Complemental strand, 20656931 - 20656887
Alignment:
| Q |
265 |
agattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
20656931 |
agattttatgcaattttgtatcggttttatgttttggttgatcca |
20656887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 254 - 309
Target Start/End: Original strand, 20487045 - 20487100
Alignment:
| Q |
254 |
tatattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||| |||| || ||||||| |
|
|
| T |
20487045 |
tatattttgcaagattttatacaattttgtgtcggttttaggtttcggctgatcca |
20487100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 259 - 309
Target Start/End: Complemental strand, 13084722 - 13084672
Alignment:
| Q |
259 |
tttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||| ||||||||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
13084722 |
tttgcgagattttatgcaattttgtatcgattttatgttttggttgatcca |
13084672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 5844181 - 5844234
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||| | |||||||||||||||| |||| | ||||||||||||||||||||| |
|
|
| T |
5844181 |
tattttactagattttatgcaatttggtgtcgattttatgttttggttgatcca |
5844234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 7440450 - 7440397
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
7440450 |
tattttgcgagattttatacaattttatgtcggttttaggttttggttgatcca |
7440397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 26297091 - 26297038
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||||||||| |||| |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
26297091 |
tattttgcaagatcttatataattttgtgtcggttttaggttttggttgatcca |
26297038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 259 - 309
Target Start/End: Complemental strand, 13013334 - 13013284
Alignment:
| Q |
259 |
tttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||| |||||||| |||||||||| | |||||||||||||||||||||| |
|
|
| T |
13013334 |
tttgcgagattttaagcaattttgtatcagttttatgttttggttgatcca |
13013284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 3631447 - 3631500
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||| ||| | ||||| ||||||||||||||| |
|
|
| T |
3631447 |
tattttgcgagattttatacaattttatgtcgattttaagttttggttgatcca |
3631500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 19577263 - 19577210
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| |||| || |||||||||||||| |
|
|
| T |
19577263 |
tattttgcaacattttatacaattttgtgtcggttctagattttggttgatcca |
19577210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 28)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 919792 - 919739
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
919792 |
tattttgcgagattttatgcaattttgtgttggttttatgttttggttgatcca |
919739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 40428863 - 40428810
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40428863 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
40428810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 257 - 309
Target Start/End: Original strand, 40567042 - 40567094
Alignment:
| Q |
257 |
attttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40567042 |
attttgcgagattttatgcaattttgtgttggttttatgttttagttgatcca |
40567094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 258 - 309
Target Start/End: Original strand, 24790512 - 24790563
Alignment:
| Q |
258 |
ttttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24790512 |
ttttgcgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
24790563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 8086305 - 8086358
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
8086305 |
tattttgctagattttatgcaattttatgtaggttttatgttttggttgatcca |
8086358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 16693031 - 16692978
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||| | ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16693031 |
tattttacgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
16692978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 24544800 - 24544747
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
24544800 |
tattttgcgagattttatgcaattttgtgtcggttttatgctttggttgatcca |
24544747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 25299170 - 25299117
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
25299170 |
tattttgcgagattttatgcaactttgtgtcggttttatgttttggttgatcca |
25299117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 33012139 - 33012086
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33012139 |
tattttgtgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
33012086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 44052541 - 44052488
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
44052541 |
tattttgcgagattttatgtaattttgtgttggttttatgttttgattgatcca |
44052488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 47561802 - 47561855
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| | ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47561802 |
tattttgcgatattttatgcaattttgtgtaggttttatgttttggttgatcca |
47561855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 51139761 - 51139814
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51139761 |
tattttgcgagattttatacaattttgtgtcggttttatgttttggttgatcca |
51139814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 307
Target Start/End: Original strand, 42372045 - 42372096
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatc |
307 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42372045 |
tattttgtgagattttatgcaattttgtgtcggttttatgttttggttgatc |
42372096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 307
Target Start/End: Original strand, 44317642 - 44317693
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatc |
307 |
Q |
| |
|
|||||||| |||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
44317642 |
tattttgcgagattttatgtaattttgtgttgattttatgttttggttgatc |
44317693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 8530158 - 8530211
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
8530158 |
tattttgcgagattttatgcaattttgtgtcgattttatgttctggttgatcca |
8530211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 259 - 309
Target Start/End: Complemental strand, 17285373 - 17285323
Alignment:
| Q |
259 |
tttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||| ||||||||||||||||| | | ||||||||||||||||||||||| |
|
|
| T |
17285373 |
tttgcgagattttatgcaattttatatcggttttatgttttggttgatcca |
17285323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 259 - 309
Target Start/End: Original strand, 29170020 - 29170070
Alignment:
| Q |
259 |
tttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||| ||||||||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
29170020 |
tttgcgagattttatgcaattttgtatcgattttatgttttggttgatcca |
29170070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 23177417 - 23177470
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||| | | |||||| |||||||||||||| |
|
|
| T |
23177417 |
tattttgcgagattttatgcaattttgtatcgattttatattttggttgatcca |
23177470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 33012026 - 33011973
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||| ||| ||||||| |||| |||||||||| |
|
|
| T |
33012026 |
tattttgcgagattttatgcaattttatgtcggttttaggtttcggttgatcca |
33011973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 40567154 - 40567207
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
40567154 |
tattttgcgagattttatacaattttatgtcggttttaggttttggttgatcca |
40567207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 42372158 - 42372211
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
42372158 |
tattttgcgagattttatacaattttatgttggttttaggtttcggttgatcca |
42372211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 46224842 - 46224789
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||| | | ||||||||||| ||||||||| |
|
|
| T |
46224842 |
tattttgcgagattttatgcaattttgtatcgattttatgtttttgttgatcca |
46224789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 48708386 - 48708333
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
48708386 |
tattttgcgagattttatacaattttatgtcggttttaggttttggttgatcca |
48708333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 259 - 306
Target Start/End: Original strand, 6849831 - 6849878
Alignment:
| Q |
259 |
tttgcaagattttatgcaattttgtgttggttttatgttttggttgat |
306 |
Q |
| |
|
||||| ||||||||| ||||||||| | |||||||||||||||||||| |
|
|
| T |
6849831 |
tttgcgagattttatacaattttgtatcggttttatgttttggttgat |
6849878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 260 - 307
Target Start/End: Original strand, 45836923 - 45836970
Alignment:
| Q |
260 |
ttgcaagattttatgcaattttgtgttggttttatgttttggttgatc |
307 |
Q |
| |
|
|||| ||||||||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
45836923 |
ttgcgagattttatacaattttgtatcggttttatgttttggttgatc |
45836970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 267 - 309
Target Start/End: Complemental strand, 29981778 - 29981736
Alignment:
| Q |
267 |
attttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
29981778 |
attttatgcaattttgtgtcggttttaagttttggtttatcca |
29981736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 37125768 - 37125821
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| | |||||||||||||||| || |||||| ||||||||||||||| |
|
|
| T |
37125768 |
tattttgcgatattttatgcaattttgcgtcagttttacgttttggttgatcca |
37125821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 48708499 - 48708446
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||| | | | ||||||||||| ||||||||| |
|
|
| T |
48708499 |
tattttgcgagattttatgcaattttatatcgattttatgtttttgttgatcca |
48708446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 5e-19; HSPs: 16)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 246 - 309
Target Start/End: Complemental strand, 24130338 - 24130274
Alignment:
| Q |
246 |
tcaacgattata-ttttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24130338 |
tcaacgattataattttgcgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
24130274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 15469165 - 15469218
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
15469165 |
tattttgcaagattttatgcaattttgtgtcggttttatgttttgattgatcca |
15469218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 16461492 - 16461439
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16461492 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
16461439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 259 - 309
Target Start/End: Complemental strand, 24635550 - 24635500
Alignment:
| Q |
259 |
tttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24635550 |
tttgcgagattttatgcaattttgtattggttttatgttttggttgatcca |
24635500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 7021893 - 7021946
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7021893 |
tattttgcgagattttatgcaattttgtgtcagttttatgttttggttgatcca |
7021946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 260 - 309
Target Start/End: Original strand, 8560505 - 8560554
Alignment:
| Q |
260 |
ttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8560505 |
ttgcgagattttatgcaattttgtattggttttatgttttggttgatcca |
8560554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 11450587 - 11450534
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| |||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11450587 |
tattttgcgagatcttatgcaattttgtgtcggttttatgttttggttgatcca |
11450534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 12698570 - 12698623
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12698570 |
tattttgcgagattttatacaattttgtgtcggttttatgttttggttgatcca |
12698623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 259 - 309
Target Start/End: Complemental strand, 9079135 - 9079085
Alignment:
| Q |
259 |
tttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||| ||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
9079135 |
tttgcgagattttatgcaattttgtatcggttttatgttttggttgatcca |
9079085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 2660921 - 2660868
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
2660921 |
tattttgcgagattttatgcaattttgtatcggttttatgttttggatgatcca |
2660868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 34127573 - 34127626
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||||| | ||||||||| ||||||||||||| |
|
|
| T |
34127573 |
tattttgcgagattttatacaattttgtatcggttttatgatttggttgatcca |
34127626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 34127686 - 34127739
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||||||||||||| ||||||| ||| ||||||| |||| |||||||||| |
|
|
| T |
34127686 |
tattttgcaagattttatacaattttatgtcggttttaggtttcggttgatcca |
34127739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 307
Target Start/End: Complemental strand, 34023625 - 34023574
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatc |
307 |
Q |
| |
|
|||||| | ||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
34023625 |
tattttacgagattttatataattttgtgtcggttttatgttttggttgatc |
34023574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 306
Target Start/End: Complemental strand, 23259147 - 23259101
Alignment:
| Q |
260 |
ttgcaagattttatgcaattttgtgttggttttatgttttggttgat |
306 |
Q |
| |
|
|||| ||||||||||||||||| | | |||||||||||||||||||| |
|
|
| T |
23259147 |
ttgcgagattttatgcaattttctatcggttttatgttttggttgat |
23259101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 13405446 - 13405393
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||||| |||| | |||||||| |
|
|
| T |
13405446 |
tattttgcgagattttatacaattttgtgtcggttttaggtttcgattgatcca |
13405393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 26468524 - 26468577
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| |||||||| |||| |||||||| |
|
|
| T |
26468524 |
tattttgcgagattttatacaattttgtgtcggttttataatttgcttgatcca |
26468577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 65009 - 65062
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
65009 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
65062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 331847 - 331900
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
331847 |
tattttgcaagattttatgcaattttgtatcggttttatgttttggttgatcca |
331900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 3e-17; HSPs: 28)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 1092961 - 1092908
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1092961 |
tattttgcgagattttatgcaattttgtgtgggttttatgttttggttgatcca |
1092908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 11232238 - 11232185
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11232238 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
11232185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 28952475 - 28952422
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28952475 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
28952422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 307
Target Start/End: Complemental strand, 29126127 - 29126076
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatc |
307 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29126127 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttggttgatc |
29126076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 256 - 306
Target Start/End: Complemental strand, 44254684 - 44254634
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgat |
306 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44254684 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttggttgat |
44254634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 22729295 - 22729348
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||| | ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22729295 |
tatttttcgagattttatgcaattttgtgtcggttttatgttttggttgatcca |
22729348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 27742561 - 27742614
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27742561 |
tattttgagagattttatgcaattttgtgtcggttttatgttttggttgatcca |
27742614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 32271003 - 32270950
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
32271003 |
tattttgcgagattttatgcaattttgtgtcggttttatattttggttgatcca |
32270950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 50527717 - 50527664
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
50527717 |
tattttgcgagattttatgcaattttgtatcggttttatgttttggttgatcca |
50527664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 52202057 - 52202110
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52202057 |
tattttgcgagattttatacaattttgtgtcggttttatgttttggttgatcca |
52202110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 265 - 309
Target Start/End: Original strand, 35083877 - 35083921
Alignment:
| Q |
265 |
agattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35083877 |
agattttatgcaattttgtgtcggttttatgttttggttgatcca |
35083921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 256 - 306
Target Start/End: Complemental strand, 13594957 - 13594907
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgat |
306 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
13594957 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttggctgat |
13594907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 18163793 - 18163846
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
18163793 |
tattttgcgagattttattcaattttgtatcggttttatgttttggttgatcca |
18163846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 256 - 308
Target Start/End: Original strand, 49169868 - 49169920
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcc |
308 |
Q |
| |
|
|||||||| | ||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
49169868 |
tattttgcgaaattttatacaattttgtgtcggttttatgttttggttgatcc |
49169920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 256 - 306
Target Start/End: Complemental strand, 21259518 - 21259468
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgat |
306 |
Q |
| |
|
||||||| ||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
21259518 |
tattttgtgagattttatgcaattttgtgtcgattttatgttttggttgat |
21259468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 44205487 - 44205541
Alignment:
| Q |
256 |
tattttgcaagattttatgcaatttt-gtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||| |||| |||||||||| |||||||||||| |
|
|
| T |
44205487 |
tattttgcgagattttatgcaatttttgtgtcggttttatgtgttggttgatcca |
44205541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 267 - 309
Target Start/End: Complemental strand, 52571497 - 52571455
Alignment:
| Q |
267 |
attttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
52571497 |
attttatgcaattttgtatcggttttatgttttggttgatcca |
52571455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 4618226 - 4618278
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||| |||| ||||||||| |
|
|
| T |
4618226 |
tattttgcaagattttatacaattttgtgtcggttttat-tttttgttgatcca |
4618278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 13594844 - 13594791
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||| ||| |||||||||||| |||||||||| |
|
|
| T |
13594844 |
tattttgcgagattttatacaattttatgtcggttttatgtttcggttgatcca |
13594791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 35083981 - 35084034
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||| ||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
35083981 |
tattttgcgagattttatacaattttatgttggttttaggtttcggttgatcca |
35084034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 267 - 309
Target Start/End: Complemental strand, 31174632 - 31174590
Alignment:
| Q |
267 |
attttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||| ||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
31174632 |
attttatacaattttgtgtcggttttaggttttggttgatcca |
31174590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 267 - 309
Target Start/End: Complemental strand, 49657284 - 49657242
Alignment:
| Q |
267 |
attttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
49657284 |
attttatgcaattttacgtcggttttatgttttggttgatcca |
49657242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 217 - 246
Target Start/End: Complemental strand, 7160451 - 7160422
Alignment:
| Q |
217 |
gcagtggcggagcctttcatgggctggggt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7160451 |
gcagtggcggagcctttcatgggctggggt |
7160422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 12251591 - 12251538
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||| ||||||||| |||||||||| | ||||||||||||||||||||| |
|
|
| T |
12251591 |
tattttgtgagattttatataattttgtgtcgattttatgttttggttgatcca |
12251538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 246
Target Start/End: Complemental strand, 28952556 - 28952523
Alignment:
| Q |
213 |
aagagcagtggcggagcctttcatgggctggggt |
246 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
28952556 |
aagagcagtggcggagcccttcatgggctggggt |
28952523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 36633562 - 36633615
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||| ||||||||| ||||||||| | | ||||||||||||||||||||| |
|
|
| T |
36633562 |
tattttgtgagattttatacaattttgtatcgattttatgttttggttgatcca |
36633615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 293
Target Start/End: Complemental strand, 52499281 - 52499244
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggtttta |
293 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
52499281 |
tattttgcgagattttatacaattttgtgttggtttta |
52499244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 256 - 308
Target Start/End: Original strand, 27742674 - 27742726
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcc |
308 |
Q |
| |
|
|||||||||||||||||| ||||||| ||| | ||||| |||| ||||||||| |
|
|
| T |
27742674 |
tattttgcaagattttatacaattttatgtcgtttttaggtttcggttgatcc |
27742726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0131 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: scaffold0131
Description:
Target: scaffold0131; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 11253 - 11306
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
11253 |
tattttgcgagattttatgcaattttgtatcggttttatgttttggttgatcca |
11306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 19121 - 19174
Alignment:
| Q |
256 |
tattttgcaagattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
19121 |
tattttgcgagattttatgcaattttgtgtcggttttatgttttggtttatcca |
19174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0978 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0978
Description:
Target: scaffold0978; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 265 - 309
Target Start/End: Original strand, 1188 - 1232
Alignment:
| Q |
265 |
agattttatgcaattttgtgttggttttatgttttggttgatcca |
309 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
1188 |
agattttatgcaattttgtgtcgattttatgttttggttgatcca |
1232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University