View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5541-Insertion-11 (Length: 157)
Name: NF5541-Insertion-11
Description: NF5541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5541-Insertion-11 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 3e-47; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 3e-47
Query Start/End: Original strand, 34 - 157
Target Start/End: Original strand, 7761572 - 7761698
Alignment:
| Q |
34 |
aaaacaagcaatgtccwgaaa-gctttttgttcca-gtcagataggccattgtagctgatttcma-tacaccctgaatctcagcatctggaacctttcta |
130 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| ||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
7761572 |
aaaacaagcaatgtccagaaaagctttttgttccaagtcagataggccattgtagctgatttccaatacaccctgaatctcagcatctggaacctttcta |
7761671 |
T |
|
| Q |
131 |
tatctctgcaattcaatatccgattcc |
157 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
7761672 |
tatctctgcaattcaatatcccattcc |
7761698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 34 - 149
Target Start/End: Original strand, 7837989 - 7838107
Alignment:
| Q |
34 |
aaaacaagcaatgtccwgaaag-ctttttgttcca-gtcagataggccattgtagctgatttcma-tacaccctgaatctcagcatctggaacctttcta |
130 |
Q |
| |
|
|||||||||||||||| |||| |||| || |||| |||||||||||| |||||||||||||| | ||||| ||||||||||||||||||||||||||| |
|
|
| T |
7837989 |
aaaacaagcaatgtccagaaaaactttctggtccaagtcagataggcctttgtagctgatttccagtacactttgaatctcagcatctggaacctttcta |
7838088 |
T |
|
| Q |
131 |
tatctctgcaattcaatat |
149 |
Q |
| |
|
||| |||||| |||||||| |
|
|
| T |
7838089 |
tatttctgcagttcaatat |
7838107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 53; E-Value: 5e-22
Query Start/End: Original strand, 67 - 156
Target Start/End: Original strand, 7754508 - 7754598
Alignment:
| Q |
67 |
agtcagataggccattgtagctgatttcmat-acaccctgaatctcagcatctggaacctttctatatctctgcaattcaatatccgattc |
156 |
Q |
| |
|
||||||||||||| |||||||||||||| || ||||| ||||||||||||||||| |||||||||||| |||| | |||||||||| |||| |
|
|
| T |
7754508 |
agtcagataggcctttgtagctgatttccattacaccttgaatctcagcatctgggacctttctatatttctgaagttcaatatcccattc |
7754598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University