View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5541-Insertion-8 (Length: 376)
Name: NF5541-Insertion-8
Description: NF5541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5541-Insertion-8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 8 - 277
Target Start/End: Complemental strand, 40515908 - 40515640
Alignment:
| Q |
8 |
ctaatatccaaacaaaacaagtacttgaaattttaagatcagaaggaaccctttacatgcgtcaaactctcttgtgccaaaaaatcatgaaaaaggtaaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40515908 |
ctaatatccaaacaaaacaagtacttgaaattttaagatatgaaggaaccctttacatgcttcaaactctcttgtggcaaaaaatcatgaaaaaggtaaa |
40515809 |
T |
|
| Q |
108 |
atttaattttgagacaagagaagttcaaagcattgtaaaagtattgtgannnnnnnactataaatgccgaatgtgtaaaaatccttacaaaagcaagtag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40515808 |
atttaattttgagacaagagaagttcaaagca-tgtaaaagtgttgtgatttttttactataaatgccgaatgtgtaaaaatccttacaaaagcaagtag |
40515710 |
T |
|
| Q |
208 |
ccaaggacaatcatagccacggctcaaccttaagaaattccaatccaccaccaatattttcatcaccagc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40515709 |
ccaaggacaatcatagccacggctcaaccttaagaaattccaatccaccaccaatattttcatcaccagc |
40515640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 330 - 376
Target Start/End: Complemental strand, 40515604 - 40515558
Alignment:
| Q |
330 |
gtgattgctagatgcaataactatttcatgccccatccaacaaccct |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40515604 |
gtgattgctagatgcaataactatttcatgccccatccaacaaccct |
40515558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University