View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5541_high_19 (Length: 284)
Name: NF5541_high_19
Description: NF5541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5541_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 20 - 191
Target Start/End: Original strand, 47197277 - 47197448
Alignment:
| Q |
20 |
ccatgatcgcatcccctgtaaccagaaagctaggacgcaaacaaactatgttgcttgctggaattttgttcattgttggcactgtcttaagtgcctcggc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47197277 |
ccatgatcgcatcccctgtaaccagaaagctaggacgcaaacaaactatgttgcttgctggaattttgttcattgttggcactgtcttaagtgcctcagc |
47197376 |
T |
 |
| Q |
120 |
agggaaacttatcctcctcatttttggcagaatcttacttggttgcggagttggttttgccaaccaggtcct |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47197377 |
agggaaacttatcctcctcatttttggcagaatcttacttggttgcggagttggttttgccaaccaggtcct |
47197448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 20 - 189
Target Start/End: Original strand, 47184240 - 47184409
Alignment:
| Q |
20 |
ccatgatcgcatcccctgtaaccagaaagctaggacgcaaacaaactatgttgcttgctggaattttgttcattgttggcactgtcttaagtgcctcggc |
119 |
Q |
| |
|
||||||| |||||||| ||||| |||||||| |||||||||| ||||||||||||||||||||||| ||||||| |||||||| ||||||||| | || |
|
|
| T |
47184240 |
ccatgattgcatccccggtaactagaaagcttggacgcaaacttactatgttgcttgctggaattttcttcattgctggcactgccttaagtgctttagc |
47184339 |
T |
 |
| Q |
120 |
agggaaacttatcctcctcatttttggcagaatcttacttggttgcggagttggttttgccaaccaggtc |
189 |
Q |
| |
|
||| | |||| |||| ||||| ||||||||||| |||||||||| || |||||||| ||||| |||||| |
|
|
| T |
47184340 |
aggcacccttagcctcatcattcttggcagaatcatacttggttgtggtgttggtttcgccaatcaggtc |
47184409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 215 - 275
Target Start/End: Original strand, 47197482 - 47197542
Alignment:
| Q |
215 |
tccatattttcatcagaaaattagacatgcattgtcacattaaaaatttaatgttgatgat |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
47197482 |
tccatattttcatcagaaaattagacatgcattgtcacattaaaagtttaatgttgctgat |
47197542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 136 - 188
Target Start/End: Complemental strand, 750899 - 750847
Alignment:
| Q |
136 |
ctcatttttggcagaatcttacttggttgcggagttggttttgccaaccaggt |
188 |
Q |
| |
|
|||||| |||||||||||||||||||||| || ||||||||||| || ||||| |
|
|
| T |
750899 |
ctcattgttggcagaatcttacttggttgtggtgttggttttgctaatcaggt |
750847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University