View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5541_high_30 (Length: 234)
Name: NF5541_high_30
Description: NF5541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5541_high_30 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 15 - 234
Target Start/End: Complemental strand, 47198065 - 47197846
Alignment:
| Q |
15 |
atcaatggaggacgattgtgggacttaacgagatccttgaagggactcttaacctcattagccactttactagctctgagtatgtcttcaaactcgggct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47198065 |
atcaatggaggacgattgtgggacttaacgagatccttgaagggactcttaacctcattagccactttactagctctgagtatgtcttcaaactcgggct |
47197966 |
T |
|
| Q |
115 |
caatattttcaacaccacgaatctttcttagaacggctttccctttctcctcgaaacccctttcaatgagactgttgggagtatcatccactatgagaga |
214 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47197965 |
caatattttcaacaccacgaatctttgtaagaacggctttccctttctcctcgaaacccctttcaatgagactgttgggagtatcatccactatgagaga |
47197866 |
T |
|
| Q |
215 |
ccccattgtaagcataactg |
234 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
47197865 |
ccccattgtaagcataactg |
47197846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 15 - 234
Target Start/End: Complemental strand, 47185183 - 47184964
Alignment:
| Q |
15 |
atcaatggaggacgattgtgggacttaacgagatccttgaagggactcttaacctcattagccactttactagctctgagtatgtcttcaaactcgggct |
114 |
Q |
| |
|
||||| ||||| |||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47185183 |
atcaaaggagggagattgtgggacttaacaagatccttgaaggggctcttgacctcattagccactttactagctctgagtatgtcttcaaactcgggct |
47185084 |
T |
|
| Q |
115 |
caatattttcaacaccacgaatctttcttagaacggctttccctttctcctcgaaacccctttcaatgagactgttgggagtatcatccactatgagaga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47185083 |
caatattttcaacaccacgaatctttcttagaacggctttccctttctcctcgaaacccctttcaatgagactgttgggagtatcatccactatgagaga |
47184984 |
T |
|
| Q |
215 |
ccccattgtaagcataactg |
234 |
Q |
| |
|
||||| |||||||||||||| |
|
|
| T |
47184983 |
ccccactgtaagcataactg |
47184964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University