View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5541_low_18 (Length: 311)
Name: NF5541_low_18
Description: NF5541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5541_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 10 - 266
Target Start/End: Original strand, 31752981 - 31753239
Alignment:
| Q |
10 |
aagaatatgtaaacatgacatatttgactatctcaccatgcttgtnnnnnnnnn-gaccacttcaaggtaaaattcaatcagcttttgtttaacaagaaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31752981 |
aagaatatgtaaacatgacatatttgactatctcaccatgcttgtaaaaaaaaaagaccacttcaaggtaaaattcaatcagcttttgtttaacaagaaa |
31753080 |
T |
|
| Q |
109 |
aaatcattaagtttatttatttgacaacgaaaatttcagttatctggtattcatttttctaatatcataattaacaacatggatatcattctaaaaatgt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
31753081 |
aaatcattaagtttatttatttgacaacgaaaatttcagttatctggtattcatttttctaatatcataattaacaacatggatatcattctaaaaacgt |
31753180 |
T |
|
| Q |
209 |
taatannnnnnnnnaaagtat-ggataatgtaaatcggatattctctgtagaccacatt |
266 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31753181 |
taatatttttttttaaagtatgggataatgtaaatcggatattctctgtggaccacatt |
31753239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University