View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5541_low_28 (Length: 240)
Name: NF5541_low_28
Description: NF5541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5541_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 19 - 191
Target Start/End: Complemental strand, 46927072 - 46926881
Alignment:
| Q |
19 |
cgttcgacaactcaacacctatgtaagcaatcatctcttcatcatatatatataatcattatgttgtaacttgtaactaactaa--------ctagttag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
46927072 |
cgttcgacaactcaacacctatgtaagcaatcatctcttcatcatatatag----tcattatgttgtaacttgtaactaactaactaactaactagctag |
46926977 |
T |
 |
| Q |
111 |
tat---------------gtcgcttcttcgattcgttggttggttttaaaaaatagtataactaactaatattctttgttattattttcaactaac |
191 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46926976 |
tataactcatcactcattgtcgcttcttcgattcgttggttggttttaaaaaatagtataactaactaatattctttgttattattttcaactaac |
46926881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 201 - 240
Target Start/End: Complemental strand, 46926658 - 46926619
Alignment:
| Q |
201 |
atcttttgttgtttagggttttagaaagattgtacctgac |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46926658 |
atcttttgttgtttagggttttagaaagattgtacctgac |
46926619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University