View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5541_low_34 (Length: 226)
Name: NF5541_low_34
Description: NF5541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5541_low_34 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 11 - 226
Target Start/End: Complemental strand, 50492509 - 50492294
Alignment:
| Q |
11 |
aatgatttggcgcaacctggaccgggtatcggaagcacgctccggcccaacaatagaattggcgccaatgttttcgcgccaaaatcagtgaaccccacca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50492509 |
aatgatttggcgcaacctggaccgggtatcggaagcacgctccggcccaacaatagaattggcgccaatgttttcgcgccaaaatcagtgaaccccacca |
50492410 |
T |
 |
| Q |
111 |
gcacccattgataaaccctcggaagttgcaaccctaaacacacaatcgaattcttcagagcaaaactgaaattgaaacacttcagagctagaagagaaga |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50492409 |
gcacccattgataacccctcggaagttgcaaccctaaacacacaatcgaattattcagagcgaaactgaaattgaaacacttcagagctagaagagaaga |
50492310 |
T |
 |
| Q |
211 |
agcgaagaatcatgga |
226 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
50492309 |
agtgaagaatcatgga |
50492294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University