View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5541_low_34 (Length: 226)

Name: NF5541_low_34
Description: NF5541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5541_low_34
NF5541_low_34
[»] chr4 (1 HSPs)
chr4 (11-226)||(50492294-50492509)


Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 11 - 226
Target Start/End: Complemental strand, 50492509 - 50492294
Alignment:
11 aatgatttggcgcaacctggaccgggtatcggaagcacgctccggcccaacaatagaattggcgccaatgttttcgcgccaaaatcagtgaaccccacca 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50492509 aatgatttggcgcaacctggaccgggtatcggaagcacgctccggcccaacaatagaattggcgccaatgttttcgcgccaaaatcagtgaaccccacca 50492410  T
111 gcacccattgataaaccctcggaagttgcaaccctaaacacacaatcgaattcttcagagcaaaactgaaattgaaacacttcagagctagaagagaaga 210  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
50492409 gcacccattgataacccctcggaagttgcaaccctaaacacacaatcgaattattcagagcgaaactgaaattgaaacacttcagagctagaagagaaga 50492310  T
211 agcgaagaatcatgga 226  Q
    || |||||||||||||    
50492309 agtgaagaatcatgga 50492294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University