View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5541_low_4 (Length: 503)
Name: NF5541_low_4
Description: NF5541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5541_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 254 - 485
Target Start/End: Complemental strand, 40516132 - 40515904
Alignment:
| Q |
254 |
ttttgcacactcataaaccaaaatagttgtttgccaatatttttagaaaatttcttttttcacccaccatgcttc-cgcacactatctcaaatttcgaaa |
352 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40516132 |
ttttgcacactcataaaccaaaatagttg----ccaatatttttagagaatttcttttttcacccaccatgcttctcgcacactatctcaaatttcgaaa |
40516037 |
T |
 |
| Q |
353 |
atgcctccaatttttaaattcgaaaatccgaatggggcttttagaccattttcaaagtgcaaaaaatttgccaaggttgaacttcggctatctgtgnnnn |
452 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40516036 |
atgcctccaatttttaaattcgaaaatccgaatggggcttttagaccattttcaaagtgcaaaaaatttgccaaggttgaacttcggctatctgtgtttt |
40515937 |
T |
 |
| Q |
453 |
nnncctgacttttcgaccattttggattctaat |
485 |
Q |
| |
|
|| ||||||||||||||||||||||||||| |
|
|
| T |
40515936 |
tttcccgacttttcgaccattttggattctaat |
40515904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 18 - 109
Target Start/End: Complemental strand, 40516355 - 40516264
Alignment:
| Q |
18 |
ggttacatctagtggaataattatgggcaaaccaacatttggttcttgtaaatgaattatctactacattggttttaaatgtatcgaaattg |
109 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40516355 |
ggttacatccagtggaataattatgggcaaaccaacatttggttcttgtaaatgaactatctactacattggttttaaatgtatcgaaattg |
40516264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University