View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5542-Insertion-5 (Length: 263)
Name: NF5542-Insertion-5
Description: NF5542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5542-Insertion-5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 8 - 244
Target Start/End: Complemental strand, 38993642 - 38993406
Alignment:
| Q |
8 |
cgaacaatttgttttataaccctcccaccaggtttatttaaacgannnnnnnnnnnnngacataaggtttctttaaacgatttgttcttgactaagattt |
107 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |||| ||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
38993642 |
cgaacaatttgttttgtaaccctcccaccaggtttatttaaacgattttttattttttgacaaaagatttctttaaacgatttgtttttgactaagattt |
38993543 |
T |
 |
| Q |
108 |
atgagccacatgagcttaactgaaattactcagtgtactcttttacggttttgagnnnnnnnagtggcaaagttataatttatttgttagagccatatta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38993542 |
atgagccacatgagcttaactgaaattacttagtgtactcttttacggttttgagtttttttagtggcaaagttataatttatttgtgagagccatatta |
38993443 |
T |
 |
| Q |
208 |
taattagtccttttttaatattataaacctattgatt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38993442 |
taattagtccttttttaatattataaacctattgatt |
38993406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University