View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5542_high_4 (Length: 311)
Name: NF5542_high_4
Description: NF5542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5542_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 13 - 295
Target Start/End: Original strand, 15338667 - 15338949
Alignment:
| Q |
13 |
tcatcatcatatctcgaaatgtggaagaaagctatagaaagagaaagaaacacaacccacttcaacaaactcgccgcttcgaacgacagcggcgtggaag |
112 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15338667 |
tcatcatcatacctcgaaatgtggaagaaagccatagaacgagaaagaaacacaaccaacttcaacaaactcgccgcttcgaacgacagcggcgtggaag |
15338766 |
T |
 |
| Q |
113 |
agaatctagagaagaaaactcaagactttcagaagattctagaggtttcaagtgaggaacgtgataggattcagagattgcaggttattgatcgtgcttc |
212 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
15338767 |
agaatttagagaagaaaactcaagactttcagaagcttctagaggtttcgagtgaggaacgtgataggattcagaggttacaggttattgatcgtgcttc |
15338866 |
T |
 |
| Q |
213 |
tgctgcaattgcagctgctagagcgcttcttaaggatgctaatagcaatagtgttcgttctgatggagatacgttacaaaaat |
295 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
15338867 |
tgctgcaattgctgctgctagagcgcttcttaaggatgctaatagcaacagtgttcgttctgatggagatatgttacaaaaat |
15338949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University