View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5543_low_13 (Length: 241)

Name: NF5543_low_13
Description: NF5543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5543_low_13
NF5543_low_13
[»] chr8 (1 HSPs)
chr8 (19-135)||(7996096-7996211)


Alignment Details
Target: chr8 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 19 - 135
Target Start/End: Complemental strand, 7996211 - 7996096
Alignment:
19 agtaagtaatcaaaaatatatattgatagtaaaggaagccatggcaaaattacctcctcaacttctctgggaaattaagctgcaaaggccatcatggagt 118  Q
    |||||||||| ||||| |||||| |||||||| ||||||| || |||||||||||||||||||||||||||||||||||| |||||||| ||| ||||||    
7996211 agtaagtaattaaaaaaatatatcgatagtaa-ggaagccgtgtcaaaattacctcctcaacttctctgggaaattaagccgcaaaggcaatcttggagt 7996113  T
119 gcatttggcgaagtcaa 135  Q
    |||||||||||||||||    
7996112 gcatttggcgaagtcaa 7996096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University