View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5543_low_13 (Length: 241)
Name: NF5543_low_13
Description: NF5543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5543_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 19 - 135
Target Start/End: Complemental strand, 7996211 - 7996096
Alignment:
| Q |
19 |
agtaagtaatcaaaaatatatattgatagtaaaggaagccatggcaaaattacctcctcaacttctctgggaaattaagctgcaaaggccatcatggagt |
118 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||| ||||||| || |||||||||||||||||||||||||||||||||||| |||||||| ||| |||||| |
|
|
| T |
7996211 |
agtaagtaattaaaaaaatatatcgatagtaa-ggaagccgtgtcaaaattacctcctcaacttctctgggaaattaagccgcaaaggcaatcttggagt |
7996113 |
T |
 |
| Q |
119 |
gcatttggcgaagtcaa |
135 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
7996112 |
gcatttggcgaagtcaa |
7996096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University