View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5544_low_6 (Length: 364)
Name: NF5544_low_6
Description: NF5544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5544_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 2e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 192 - 346
Target Start/End: Complemental strand, 38516644 - 38516478
Alignment:
| Q |
192 |
aaccctaacctaattacaaccatatatttataacagtacgttcttcacaaaacctacaattcactcaaccacagca------------gctagctagaaa |
279 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38516644 |
aaccctaacctaattacatccatatatttataacagtacgttcttcacaaaacctacaattcactcaaccacagcatctcctaaactagctagctagaaa |
38516545 |
T |
|
| Q |
280 |
gatgaagaaccaacaacatcaaatgttcatgtgtctttgtgttttggctctcatcataggtggctgt |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38516544 |
gatgaagaaccaacaacatcaaatgttcatgtgtctttgtgttttggctctcatcataggtggctgt |
38516478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 13 - 125
Target Start/End: Complemental strand, 38516820 - 38516708
Alignment:
| Q |
13 |
aaaataatgacgtttagctaccgtggaagtgccttaatatagagatccatcatctctcctcaatctcatcattaaataggaaacgagaccacactattgc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38516820 |
aaaataatgacgtttagctaccgtggaagtgccttaatatagagatccatcatctctcctcaatctcatcattaaataggaaacgagaccacactattgc |
38516721 |
T |
|
| Q |
113 |
atttactcatcaa |
125 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38516720 |
atttactcatcaa |
38516708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University