View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5545_high_4 (Length: 206)
Name: NF5545_high_4
Description: NF5545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5545_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 14 - 162
Target Start/End: Complemental strand, 30232603 - 30232455
Alignment:
| Q |
14 |
gataattctacacaggaaaaggtgcaggtcattgttaatctagtcatagaaaagaatgttgaaaatcttacacaattacgggggtgatatggtaggaaga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
30232603 |
gataattctacacaggaaaaggtgcaggtcattgttaatctagtcatagaaaagaatgttgaaaatcttaaacaattatgggggtgatatggtaggaaga |
30232504 |
T |
|
| Q |
114 |
ggatacatgaagtactgaagtgatggcgaaaacttaaatgctacatgat |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30232503 |
ggatacatgaagtactgaagtgatggcgaaaacttaaatgctacatgat |
30232455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University