View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5545_low_5 (Length: 206)

Name: NF5545_low_5
Description: NF5545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5545_low_5
NF5545_low_5
[»] chr3 (1 HSPs)
chr3 (14-162)||(30232455-30232603)


Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 14 - 162
Target Start/End: Complemental strand, 30232603 - 30232455
Alignment:
14 gataattctacacaggaaaaggtgcaggtcattgttaatctagtcatagaaaagaatgttgaaaatcttacacaattacgggggtgatatggtaggaaga 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||    
30232603 gataattctacacaggaaaaggtgcaggtcattgttaatctagtcatagaaaagaatgttgaaaatcttaaacaattatgggggtgatatggtaggaaga 30232504  T
114 ggatacatgaagtactgaagtgatggcgaaaacttaaatgctacatgat 162  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
30232503 ggatacatgaagtactgaagtgatggcgaaaacttaaatgctacatgat 30232455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University