View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5546-Insertion-4 (Length: 549)
Name: NF5546-Insertion-4
Description: NF5546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5546-Insertion-4 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 518 - 549
Target Start/End: Complemental strand, 28710271 - 28710240
Alignment:
| Q |
518 |
aaaattcattgtttattgaatatggtaaagat |
549 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28710271 |
aaaattcattgtttattgaatatggtaaagat |
28710240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University