View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5546_high_2 (Length: 271)
Name: NF5546_high_2
Description: NF5546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5546_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 28 - 258
Target Start/End: Complemental strand, 43033124 - 43032896
Alignment:
| Q |
28 |
atcatattactaatagacagtatccatatcaatgtaatatattgaaccatgtcattctcctttacaaattgaaccccatatcccaacaacaagaaaaata |
127 |
Q |
| |
|
||||||||| ||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
43033124 |
atcatattaataatagatagtatttatatcaatgtaatatattgaaccctgtcattctcctttacaaattgaaccccatat----acagcaagaaaaata |
43033029 |
T |
|
| Q |
128 |
aattgaacacaagacatcatt--tatacaaagaaacaaggattgaaaaaagtagacaaacctcagctaattctttagagcattgaaagagcttcaagcca |
225 |
Q |
| |
|
|||||| || |||||||||| |||||||| || |||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43033028 |
aattgagcataagacatcatggatatacaaacaagcaagtattgaagaaagtagacaaacctcagctaattctttagagcattgaaagagcttcaagcca |
43032929 |
T |
|
| Q |
226 |
attaacttaaaccccttcttctcaaacctagaa |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43032928 |
attaacttaaaccccttcttctcaaacctagaa |
43032896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University