View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5547_low_2 (Length: 483)
Name: NF5547_low_2
Description: NF5547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5547_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 3e-49; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 42129562 - 42129443
Alignment:
| Q |
1 |
attataaaaagtattcatttcggagagccacgattgttgccattacttacctcgcgatcaaaatccgaataatcaaaatcaaacggtttgtttttcagac |
100 |
Q |
| |
|
||||||||||||||| ||||||||||| | |||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42129562 |
attataaaaagtatttatttcggagagtcgcgattgttgccattacttacctcgggatcaaaatccaaataatcaaaatcaaacggtttgtttttcagac |
42129463 |
T |
|
| Q |
101 |
agattttaaacacaaaccgt |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42129462 |
agattttaaacacaaaccgt |
42129443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 42129376 - 42129272
Alignment:
| Q |
187 |
tgatcgatgcacatacttaattttatgtaattttaaaatatggagttggaa-ttgtgtgttcacatgacccaacaacatttcaaatggaaaatacttgtt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42129376 |
tgatcgatgcacatacttaattttatgtaattttaaaatatggagttggaaattgtgtgttcacatgacccaacaacatttcaaatggaaaatacttgtt |
42129277 |
T |
|
| Q |
286 |
taatt |
290 |
Q |
| |
|
||||| |
|
|
| T |
42129276 |
taatt |
42129272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 389 - 467
Target Start/End: Complemental strand, 42129173 - 42129095
Alignment:
| Q |
389 |
aagggaatgacattaaggggttgttgggcatgaatttctattttggtttagtagacaaataatctttttaccaacaact |
467 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42129173 |
aagggagtgacattaaggggttgttgggcatgaatttctattttggtttagtagacaaataatctttttaccaacaact |
42129095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University